ID: 1148627590

View in Genome Browser
Species Human (GRCh38)
Location 17:49081577-49081599
Sequence CTCCTTGGGCACTGTGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148627585_1148627590 -9 Left 1148627585 17:49081563-49081585 CCTTTTTCATCCTCCTCCTTGGG No data
Right 1148627590 17:49081577-49081599 CTCCTTGGGCACTGTGGAAGAGG No data
1148627582_1148627590 13 Left 1148627582 17:49081541-49081563 CCTCGATATTCACAAAGTCCTTC No data
Right 1148627590 17:49081577-49081599 CTCCTTGGGCACTGTGGAAGAGG No data
1148627581_1148627590 17 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627590 17:49081577-49081599 CTCCTTGGGCACTGTGGAAGAGG No data
1148627583_1148627590 -5 Left 1148627583 17:49081559-49081581 CCTTCCTTTTTCATCCTCCTCCT No data
Right 1148627590 17:49081577-49081599 CTCCTTGGGCACTGTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148627590 Original CRISPR CTCCTTGGGCACTGTGGAAG AGG Intergenic
No off target data available for this crispr