ID: 1148627775

View in Genome Browser
Species Human (GRCh38)
Location 17:49083150-49083172
Sequence AAAAACACCCAGATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148627775_1148627778 -4 Left 1148627775 17:49083150-49083172 CCCAGCTGCATCTGGGTGTTTTT No data
Right 1148627778 17:49083169-49083191 TTTTTGAGGCTATAGTTTGATGG No data
1148627775_1148627779 17 Left 1148627775 17:49083150-49083172 CCCAGCTGCATCTGGGTGTTTTT No data
Right 1148627779 17:49083190-49083212 GGCCATGCCTTTCATATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148627775 Original CRISPR AAAAACACCCAGATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr