ID: 1148634627

View in Genome Browser
Species Human (GRCh38)
Location 17:49138957-49138979
Sequence GATAATGCACACAAAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148634627 Original CRISPR GATAATGCACACAAAGCTCT TGG Intronic
901798848 1:11695649-11695671 AATAATGCCTATAAAGCTCTGGG + Intronic
902306166 1:15541112-15541134 TATAATGTATATAAAGCTCTAGG + Intronic
902595508 1:17506887-17506909 GAAAATGCTCACAAAGCCCTTGG - Intergenic
908009841 1:59764786-59764808 GATAATGCATATAAAGCACTCGG + Intronic
908059481 1:60331828-60331850 GATAATGCATATGAAGCACTTGG + Intergenic
908256770 1:62309614-62309636 GATAGTGCACTTAAAGCCCTTGG - Intronic
908905989 1:69009936-69009958 GATAAAGCACAGAAAGCAATAGG - Intergenic
910104223 1:83613541-83613563 GAAGATGGACACAAATCTCTTGG + Intergenic
911264303 1:95725284-95725306 ATAAATGCACATAAAGCTCTTGG + Intergenic
913207982 1:116558825-116558847 GTTAATACACAAACAGCTCTTGG - Intronic
916606890 1:166351816-166351838 AATATTGCACACAAACCACTAGG + Intergenic
916852751 1:168720173-168720195 GATAATGCCTACAAAACTCTCGG + Intronic
919334353 1:196213024-196213046 GACTATCCACACAAAGCCCTAGG - Intergenic
919835071 1:201567819-201567841 TATAATACACACAAGGCTTTGGG - Intergenic
920695311 1:208177470-208177492 GTTAATACATGCAAAGCTCTAGG + Intronic
922039586 1:221883535-221883557 GACAATGCATACAAAGGTTTGGG + Intergenic
922452741 1:225750120-225750142 GATAGTGCACAGAAAGCTCTTGG + Intergenic
923264752 1:232303766-232303788 GATAATGCAGATAAAGTTCTTGG + Intergenic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924217055 1:241833325-241833347 GAAAATGCACACACAGCTAAGGG - Intergenic
924401085 1:243683060-243683082 GAAAATGAACACAAAACTCTAGG + Intronic
1063331910 10:5168210-5168232 TATAATGCTTACAAAGATCTGGG - Intergenic
1064585846 10:16838526-16838548 GATGATGCACAAAAATCTTTGGG + Intronic
1064946321 10:20793995-20794017 GATATTGGAAACAAAGCACTGGG - Intronic
1066960238 10:42215995-42216017 GATAATGGAGACAGAGTTCTTGG + Intergenic
1067323607 10:45245431-45245453 GATGATGCACAAAAATCTCTGGG + Intergenic
1067340282 10:45395737-45395759 GGTCATGCACATAAAGCACTCGG + Intronic
1067683188 10:48452807-48452829 GATGATACAAACAAAGCACTTGG + Intronic
1068011775 10:51460654-51460676 GATAATGCACAGAAAGCTTATGG + Intronic
1068210931 10:53919474-53919496 AATAATGCACAGAAAACACTTGG - Intronic
1068571855 10:58638599-58638621 GATGAGGCACACACAGCTCTTGG - Intronic
1069267760 10:66484131-66484153 GCTAATGCAACCAAAGCTCCTGG + Intronic
1069533472 10:69235877-69235899 GATAATGCGCATAAAGCATTTGG - Intronic
1070285455 10:75080253-75080275 GATAATGCATATAAAGCTCTTGG + Intergenic
1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG + Intronic
1071878613 10:89869921-89869943 GATAGTGCACATAAAGCACCTGG + Intergenic
1072358949 10:94640125-94640147 CATAGTGCAAACAAAGCTCCAGG - Intergenic
1072631261 10:97148203-97148225 GAAAATGCACATAAAGTTTTTGG + Intronic
1072752141 10:97988796-97988818 AATAATGCACACAAAATGCTTGG - Intronic
1080443391 11:32315368-32315390 GATAATGCATACAAAGCTCCTGG - Intergenic
1082079555 11:48001614-48001636 GCCAATACACACAAAGCACTGGG - Intronic
1082661537 11:55918084-55918106 GATGATGGTAACAAAGCTCTTGG - Intergenic
1084551010 11:69842095-69842117 GTTAATTCACATAGAGCTCTTGG + Intergenic
1084603712 11:70160987-70161009 GTTAATGCACAGAAAGCCCCTGG + Intronic
1085756659 11:79207360-79207382 GATAATACACATAAAGCACTTGG - Intronic
1086121209 11:83306146-83306168 GATAATGCATACAAAGCACTTGG + Intergenic
1086375181 11:86192968-86192990 CATAATCCACATAAAGCACTTGG + Intergenic
1087943423 11:104128799-104128821 GATAATGCACATGAAGTTCTTGG + Intronic
1089364972 11:117915896-117915918 CATAATGCACATAAAGGCCTCGG - Intronic
1089399420 11:118155894-118155916 GGTAATGCACACGCAGCTCTTGG + Intergenic
1090834698 11:130445881-130445903 GAGAATGCACATATAACTCTTGG + Intergenic
1091161480 11:133425443-133425465 TATAATGAAGACAAAGCCCTGGG - Intronic
1091809852 12:3387647-3387669 GATAATGCATGTAAAGTTCTTGG - Intronic
1092088767 12:5786890-5786912 GATCATGCACACAAAGGGCATGG + Intronic
1099313334 12:81054853-81054875 GATAATGCATATAAAGTGCTTGG - Intronic
1100790139 12:98121112-98121134 GATAATGTATATAAAGCACTTGG + Intergenic
1101331219 12:103759309-103759331 GATAATGCATGCAAAGTTCCTGG + Intronic
1101802168 12:108031986-108032008 GATAATGGACAAAATGCTGTAGG + Intergenic
1102854858 12:116284860-116284882 GTTACTGTACACAAAGCACTTGG + Intergenic
1103363098 12:120365387-120365409 GATAATGCATACAAAGCATTTGG + Intronic
1105541805 13:21322369-21322391 GAGAATGCACACACAGATTTAGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108274381 13:48792728-48792750 TATAATGTATACAAAGCTATTGG + Intergenic
1108280472 13:48856246-48856268 GATAATGAACATAAAGCACTTGG - Intergenic
1108501113 13:51070840-51070862 CATAATGCACATAAAGCCCTTGG - Intergenic
1110476318 13:75918406-75918428 CAAAATGCACAAAAATCTCTTGG + Intergenic
1111329833 13:86750881-86750903 GTTAAAGCACACCAATCTCTAGG + Intergenic
1112065930 13:95793040-95793062 GAAAATGCAAACAAGCCTCTGGG - Exonic
1114159194 14:20144147-20144169 GATAATGCATAGCAGGCTCTAGG - Exonic
1114564477 14:23619725-23619747 GACAATTTACACAAAGTTCTAGG - Intergenic
1114565599 14:23630423-23630445 GATTATCAATACAAAGCTCTTGG + Intronic
1115334001 14:32227356-32227378 GATAATGGAGACAAAGATCTTGG - Intergenic
1116457637 14:45137200-45137222 GATGAAGCTCATAAAGCTCTCGG + Exonic
1117022411 14:51584984-51585006 GTTAATACACATAAAGCCCTTGG + Intronic
1117641325 14:57802293-57802315 GATAATGTACCAAAATCTCTGGG + Intronic
1118156404 14:63246557-63246579 GATAATTCACATAAAGCACTTGG + Intronic
1119106644 14:71931641-71931663 GATATTGCACACAAATCCCACGG + Intergenic
1119583312 14:75807533-75807555 GATAATGCATATAAAGTCCTTGG - Intronic
1119613287 14:76081811-76081833 GCTAATGCACATAGAGATCTGGG + Intronic
1119643010 14:76328912-76328934 GATCAAACACACACAGCTCTTGG - Intronic
1119912961 14:78367847-78367869 GATAATGTAAACAAAGCTGTGGG + Intronic
1119969657 14:78955617-78955639 CAGAATGCACCCAAAGCTCAAGG - Intronic
1120115987 14:80618018-80618040 GATAATGCACGTAAAACACTTGG + Intronic
1120883366 14:89432475-89432497 AATAATGCAGGTAAAGCTCTTGG - Intronic
1121617952 14:95326112-95326134 GATAATACATACAAAGCACTTGG - Intergenic
1122049601 14:99046972-99046994 GATAATGCACATAAAAGTTTTGG - Intergenic
1202932056 14_KI270725v1_random:46720-46742 GATAATGGAGACAGAGTTCTTGG - Intergenic
1126166499 15:45658505-45658527 GAAAATCCACAGAAAGCACTGGG + Intronic
1126389789 15:48134686-48134708 GTTAATCCACAAATAGCTCTTGG + Exonic
1126992851 15:54402963-54402985 GATAATGCACAGAAAGCACCTGG + Intronic
1129198394 15:73984379-73984401 GATAATGTACAAAAAGTACTTGG + Intronic
1129984376 15:79904433-79904455 GTTAATGTAAACAAAGCACTTGG - Intronic
1130165407 15:81452132-81452154 AACAATGCACACAAAGATGTAGG - Intergenic
1130395600 15:83498416-83498438 GATAATAAAGGCAAAGCTCTTGG + Intronic
1133770003 16:8862318-8862340 AATAATACACACTAAGCACTGGG + Intronic
1134776862 16:16860772-16860794 GATAACGCACAGAGTGCTCTTGG + Intergenic
1134864060 16:17589076-17589098 GATAAAGCACATAAAGGACTTGG + Intergenic
1134875189 16:17691849-17691871 GATAATGCAGAATAATCTCTTGG - Intergenic
1135431577 16:22388275-22388297 GGTAATGTACACAATGCACTTGG - Intronic
1135928265 16:26714337-26714359 GATGATGCAGGCAAAGCTTTTGG + Intergenic
1135947781 16:26880147-26880169 GATCATGTACCCAAAGCACTGGG - Intergenic
1137036285 16:35572693-35572715 TATAATACATGCAAAGCTCTGGG - Intergenic
1137704112 16:50522098-50522120 GATAATGAACACAAAGCAGTTGG - Intergenic
1138289520 16:55835018-55835040 GATCCTGCATACAAAACTCTCGG - Intergenic
1138890994 16:61144030-61144052 GAAAATGAAGACAAAGATCTGGG - Intergenic
1138944269 16:61828880-61828902 GATAATTCAGGCAAAGTTCTTGG + Intronic
1139206647 16:65035236-65035258 GATAATGATCACCAAGCCCTGGG - Intronic
1140801610 16:78493393-78493415 ATTTATGCACACAAAGCTTTGGG + Intronic
1141301715 16:82822059-82822081 GTTAATTCACACAAAGTCCTTGG - Intronic
1141808832 16:86360295-86360317 GCTGATGAAGACAAAGCTCTCGG - Intergenic
1142754077 17:2005308-2005330 GACAATGCTTATAAAGCTCTTGG - Intronic
1143799988 17:9370994-9371016 GAAAATCCACACAAAAATCTCGG + Intronic
1145782726 17:27573841-27573863 AATAATGTATACAAAGCCCTAGG + Intronic
1146470406 17:33119983-33120005 GTTAAGGCTCACAAAGCTCTTGG + Intronic
1146511979 17:33457740-33457762 GACAATGCATGCAAAGCCCTTGG - Intronic
1147843612 17:43389661-43389683 GATAATGCACGTAGAGCCCTCGG - Intergenic
1148038888 17:44690393-44690415 GATAATGCATGAAAAGCTTTTGG - Intergenic
1148634627 17:49138957-49138979 GATAATGCACACAAAGCTCTTGG + Intronic
1149355858 17:55838700-55838722 GATAATGCACATAAATTGCTTGG - Intronic
1155518811 18:26649027-26649049 GATAATGAAACCAAAGCTTTGGG + Intronic
1156009211 18:32476540-32476562 GAAAATGCACACACTGCACTCGG + Intergenic
1156376891 18:36522807-36522829 GATCATGCACACACATTTCTTGG - Intronic
1156472038 18:37383419-37383441 TAAAATGCACCCCAAGCTCTCGG - Intronic
1156573780 18:38289167-38289189 GAGAAAGCACAGAATGCTCTAGG - Intergenic
1157013634 18:43682512-43682534 GCTAATGCTCAAAAATCTCTCGG + Intergenic
1157440789 18:47710115-47710137 GATAATCCACAAAAAGCACCTGG - Intergenic
1158395162 18:57073594-57073616 GATGATGCATATAAAGCCCTCGG - Intergenic
1158618443 18:59009151-59009173 AATAATGCAGACAAAGTTCAAGG + Intergenic
1158734430 18:60063352-60063374 TTTAATGCACCCAGAGCTCTAGG + Intergenic
1159480303 18:68981612-68981634 GAAAAAACACACAAAGCCCTTGG + Intronic
1159586315 18:70286945-70286967 AATAATGCACAAAAACCCCTAGG - Intergenic
1159642057 18:70875306-70875328 GATAATGCATAAAAAGTACTCGG - Intergenic
1161934447 19:7362987-7363009 GATAATGTACACAAAGTGCCTGG - Intronic
1162083937 19:8237193-8237215 GATAATGAACAGAAAGCTGGAGG - Intronic
1163910231 19:20183101-20183123 GAGAATGCAGAGAAAGCTCTGGG - Intronic
1163932628 19:20411801-20411823 GAGAATGCAGAGAAAGCTCTGGG + Intergenic
1164190312 19:22909951-22909973 GATATTGAACACAAATATCTTGG - Intergenic
1167127933 19:47563951-47563973 GTTAATGCATATAAAGCACTTGG - Intergenic
1167194353 19:48017003-48017025 GATATTGTATACAAAGCTCTTGG - Intronic
1167931753 19:52871700-52871722 AATTGTGCACACATAGCTCTAGG + Intronic
1168139947 19:54379192-54379214 GATAATGTACTCACAGCTGTGGG - Intergenic
1168410431 19:56136586-56136608 GTTAATACACGCAAAGCACTCGG - Intronic
924981880 2:230447-230469 AACAATGCACACAAATCCCTCGG + Intronic
927407499 2:22788196-22788218 AATATGGCACACAAAGTTCTAGG + Intergenic
928422533 2:31149933-31149955 GATAATGTATACAAAGCACCTGG + Intronic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
931905066 2:66833646-66833668 GATAATGCATACAAAGTGCTTGG + Intergenic
932498362 2:72158966-72158988 GATAATGCATGCCAAGCACTTGG + Intergenic
932527904 2:72491893-72491915 GATAATGCAATCATAGTTCTTGG - Intronic
932836533 2:75043285-75043307 GATAATGCACATACAGTGCTTGG + Intergenic
932842910 2:75100272-75100294 GATGATGCATGCAAAGTTCTTGG + Intronic
934463037 2:94231808-94231830 GATAATGGAGACAGAGTTCTTGG - Intergenic
935421463 2:102873689-102873711 AGCAATTCACACAAAGCTCTGGG - Intergenic
935832830 2:107018570-107018592 GATAATGCACATAAGGCTCTTGG + Intergenic
935861375 2:107333947-107333969 GAAAATGCAGACAAAAATCTTGG + Intergenic
937414762 2:121705508-121705530 AAGAACGCACACAAAGCTCTGGG - Intergenic
937742506 2:125373268-125373290 GATAATACACACAAAGTACTTGG - Intergenic
938551996 2:132391109-132391131 GATGACCCCCACAAAGCTCTTGG + Intergenic
941785885 2:169497943-169497965 GATAATGCATGAAAAGCCCTCGG - Intronic
944489944 2:200248180-200248202 GATAATGCATGTAAAGCACTTGG + Intergenic
945923951 2:215784524-215784546 GAGAATAAACACAAAGCTCAAGG + Intergenic
946181427 2:217951402-217951424 GTTAATCCCCACAAAGCTCTAGG - Intronic
946465985 2:219912709-219912731 GATACTGGACACAGAGCCCTTGG - Intergenic
946722263 2:222622152-222622174 AATCATGTACACAAAGCCCTTGG + Intronic
947811441 2:233006699-233006721 GATGGTGCACAGAAAGCTCTTGG - Intronic
948377611 2:237531971-237531993 AATAATTCAAACAAAGCTGTTGG - Intronic
1168982609 20:2020742-2020764 GATAATGCATATAAAGCATTTGG - Intergenic
1169965520 20:11213351-11213373 CACGATGCACACAAATCTCTGGG - Intergenic
1170130731 20:13016862-13016884 GATGATGAACATAAAGCACTGGG - Intronic
1172743023 20:37184093-37184115 GATGATGCACACCAAGATCTGGG - Intronic
1173102627 20:40101331-40101353 GATAATTCACATAAAGCACTTGG - Intergenic
1173441132 20:43077238-43077260 GATAATGCACATGAAGCCCTTGG - Intronic
1173787730 20:45806875-45806897 GATGATACAAACAAAGCTCTTGG - Intronic
1174458692 20:50667675-50667697 GATACTGAACTCACAGCTCTGGG + Intronic
1174860405 20:54086099-54086121 GATAATGCACAGCACGCGCTTGG + Intergenic
1175765004 20:61586362-61586384 GTTAATGCACATAAAGAGCTTGG - Intronic
1176594085 21:8674858-8674880 GATAATGGAGACAGAGTTCTTGG - Intergenic
1177157152 21:17512001-17512023 GATAATGCACAAAAAATGCTTGG - Intergenic
1179948188 21:44694749-44694771 AATAATGCACACAAGGCTGCAGG + Intronic
1180276939 22:10651988-10652010 GATAATGGACACAGAGTTCTTGG - Intergenic
1181726135 22:24812266-24812288 GATAATGCTCAGAAAGTTCATGG - Intronic
1182047329 22:27285641-27285663 GAAACTGCTCACAAAACTCTTGG - Intergenic
1182514962 22:30851304-30851326 GATAATCCACCCAAAGGGCTGGG + Intronic
1183265349 22:36821574-36821596 GATAAAGCACATAAAGCACTAGG - Intergenic
949495696 3:4629720-4629742 GACAAACCACACAAAGCTGTGGG + Intronic
949566905 3:5253475-5253497 GACAATGTACATAAAGCACTGGG - Intergenic
952661663 3:35857667-35857689 GATCATTCACACAAAGTACTAGG - Intergenic
952673366 3:35997821-35997843 TATGATGTACACAAATCTCTGGG - Intergenic
955330477 3:58043044-58043066 AATAATGCAGACAAAACTCTAGG - Intronic
955762285 3:62300014-62300036 GATGATGCATGCAAAGATCTTGG + Intergenic
955803458 3:62709509-62709531 GATACTGTATACAAAGCACTTGG + Intronic
955810992 3:62789202-62789224 GATAGTACATATAAAGCTCTTGG - Intronic
955986692 3:64581090-64581112 AATAATGCACACAAAGGACCTGG + Intronic
959882412 3:111459866-111459888 GAAAATGCACACACAGGTCTGGG + Intronic
960139750 3:114140526-114140548 GATAAGGGGTACAAAGCTCTTGG - Intronic
961108928 3:124267297-124267319 TTTAATGCACACAAATCTCCTGG + Intronic
961517778 3:127448958-127448980 GATAAAGCCCACAAAGCACTGGG - Intergenic
962676511 3:137762199-137762221 GTTAATGCAAACCAAGCTCTTGG - Intergenic
963532319 3:146486131-146486153 GACAATGTACCCAAATCTCTGGG + Intronic
969842071 4:9890028-9890050 GAAAATGCACTGAAAGCACTTGG - Intronic
969902038 4:10359108-10359130 TATAATTGACAGAAAGCTCTAGG + Intergenic
970184475 4:13435192-13435214 GATAATATACCCAAACCTCTGGG + Intronic
970567048 4:17341688-17341710 GAAAATTCACAGAAAGCTTTTGG - Intergenic
971092779 4:23363952-23363974 GATCATACACATAAAGGTCTTGG + Intergenic
971572759 4:28234297-28234319 GAAAATGAACTCAAAGCACTTGG - Intergenic
972171629 4:36352710-36352732 GATTATACACAAAAAGATCTTGG - Intergenic
972273590 4:37535995-37536017 GATCATGCACATAAAGTGCTTGG + Intronic
972383176 4:38538175-38538197 AATAATGCAACCAAAGCACTTGG + Intergenic
972388062 4:38586868-38586890 GATAATACATGTAAAGCTCTTGG - Intergenic
972601701 4:40578773-40578795 GGTAACGCACACAAAGTGCTTGG + Intronic
972741147 4:41887279-41887301 GATAATTCACATAAAGCACTTGG - Intergenic
974681726 4:65173338-65173360 GATAATGTAGAAAAAGCTGTTGG + Intergenic
975180710 4:71340719-71340741 GATAATGAGACCAAAGCTCTAGG - Intronic
975651195 4:76595158-76595180 GATAATACATATAAAGCACTTGG + Intronic
976000971 4:80372622-80372644 GATAAACCCTACAAAGCTCTGGG - Intronic
977537712 4:98275406-98275428 CATAATGCAAACACAGCTATAGG + Intronic
978509664 4:109502632-109502654 GATAATGAAGACAAAGGTCTAGG + Intronic
978627703 4:110705895-110705917 GATAATGCACATAAAGCACCTGG + Intergenic
979343584 4:119558200-119558222 GATAAAGCATAGTAAGCTCTTGG - Intronic
979416052 4:120440270-120440292 GATAATCTACACAAAGTGCTTGG + Intergenic
979523309 4:121692780-121692802 AATAATGCACACAAAAGACTTGG + Intronic
980142394 4:128935470-128935492 GATAATGAATACACAGATCTAGG - Intronic
981880104 4:149600263-149600285 GATAATACACATAAAGCACAAGG - Intergenic
985287284 4:188349290-188349312 GCTAAGGCACACCAAGCCCTAGG - Intergenic
988121145 5:26964602-26964624 GATAATGCACTCATAGTGCTAGG - Intronic
990178556 5:53134725-53134747 GATAATCCATACAAAGCACATGG + Intergenic
991476964 5:67032113-67032135 GATAATTCACAGAAAGATTTAGG - Intronic
991630676 5:68653797-68653819 GGTAATGCACATAAAGTGCTTGG + Intergenic
992003241 5:72455195-72455217 GACAATGCCCACACAGGTCTAGG + Intronic
993745243 5:91589109-91589131 GATAATGAACTCAAAGTTCAAGG + Intergenic
995208189 5:109506193-109506215 TATAATGCACACACATCTCTAGG - Intergenic
996171251 5:120294320-120294342 GATAATGAACATAAATCTCTTGG - Intergenic
997034010 5:130165225-130165247 GCTATTGCAGACAAAGTTCTTGG + Intronic
997851002 5:137332391-137332413 GATGAAGCACACAGAGTTCTCGG - Intronic
998113419 5:139519055-139519077 GATAAAGCACACAAAGGACGTGG - Intergenic
998757315 5:145395098-145395120 GATAATGCACTAAAAGCACTTGG - Intergenic
998870695 5:146548741-146548763 GATAATGCACGGAAAGCCCCTGG - Intergenic
998946746 5:147348047-147348069 GATACAGCACACAAAGTTTTTGG + Intronic
998988068 5:147783712-147783734 GATAATGCACTAAAAGCACTTGG + Intergenic
999009104 5:148015536-148015558 GATAATACACATAAAGCACTTGG + Intergenic
999103353 5:149046304-149046326 CATATTGCTCATAAAGCTCTGGG - Intronic
1000117913 5:158170754-158170776 GATGATGCATATAAAGCTGTTGG + Intergenic
1000138198 5:158374620-158374642 GATACTGCACACATAGCACTAGG + Intergenic
1000918065 5:167106109-167106131 GATAATGCCTATAAAGCTCTTGG + Intergenic
1001246159 5:170106841-170106863 GATAATGTACACAAGGTTTTAGG + Intronic
1001323036 5:170698536-170698558 GATAGTGCACATGAAGCCCTAGG + Intronic
1003039864 6:2677803-2677825 GATAATGTCTACAAAGCACTTGG + Intronic
1003309139 6:4953560-4953582 GCTGATGCCCAGAAAGCTCTGGG - Intronic
1003410348 6:5856420-5856442 GAGAATGCACACACAGATTTAGG + Intergenic
1004112363 6:12731590-12731612 GATAATAAATACAAAGCCCTTGG - Intronic
1005356036 6:24984528-24984550 GATAATGCATTTAAAGCACTTGG + Intronic
1005502119 6:26437851-26437873 GATAAAGGAGACAAATCTCTGGG + Intergenic
1006417981 6:33916165-33916187 GAGAATTCACACAAAGGTCTCGG + Intergenic
1014388299 6:120828852-120828874 GATAAGGCATATAAAGCTCTTGG - Intergenic
1015062937 6:128989586-128989608 GATAAAGCATACAAAGGGCTTGG + Intronic
1017089861 6:150749776-150749798 GAAAATGCACCCAAAGGGCTGGG + Intronic
1018470176 6:164088623-164088645 AATAATGAACAAAAAACTCTAGG + Intergenic
1018804773 6:167249984-167250006 GACAATGCACCCGGAGCTCTTGG - Intergenic
1020528317 7:9294406-9294428 GAAAATGCACATAAAGCCCTTGG - Intergenic
1021942993 7:25697847-25697869 GATAATGTGCAAAATGCTCTTGG - Intergenic
1022427468 7:30283213-30283235 GATACTGCATATAAAGCACTGGG + Intergenic
1023853372 7:44163280-44163302 GATAATGCAGGTAAGGCTCTTGG + Intronic
1024196114 7:47060618-47060640 GATCATCCACCCAAAGCTCCCGG - Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1028021121 7:85774566-85774588 GATAAAGCACACAAAGCCTTGGG + Intergenic
1028978092 7:96936302-96936324 GATAATGTAAACGAAGCACTTGG - Intergenic
1032972419 7:137180354-137180376 TATAATGCCTACAAATCTCTAGG + Intergenic
1033936891 7:146596870-146596892 AATAATGCAAAGAAAGCCCTTGG + Intronic
1035145710 7:156813260-156813282 AATAATACAGAAAAAGCTCTGGG + Intronic
1037590902 8:20311253-20311275 GATGCTGCACACAAAGGGCTGGG + Intergenic
1038986200 8:32813142-32813164 GATAATGCACATACAGCAATTGG - Intergenic
1040908981 8:52499085-52499107 AATAATTCACTCAAATCTCTAGG - Intergenic
1041359164 8:57032498-57032520 AATAATCCACAACAAGCTCTGGG + Intergenic
1041705972 8:60846711-60846733 GATAATCCATACAAAGCGCTTGG - Intronic
1042417903 8:68546155-68546177 ACTAATGCACACAAAGCAGTTGG + Intronic
1043110354 8:76171895-76171917 GAGACTGCACACAAAACTCAAGG + Intergenic
1044045522 8:87426740-87426762 GATTATGCACACTAAGTGCTAGG - Intronic
1044064560 8:87683599-87683621 GACAATACACTCTAAGCTCTAGG + Intergenic
1044163090 8:88945420-88945442 GATACTGCCCAGAAACCTCTTGG + Intergenic
1045024891 8:98077189-98077211 GATAATCCACACAAAGCTCCAGG + Intronic
1045595282 8:103648095-103648117 GACAATGTACCCAAAGCTCTGGG - Intronic
1046286370 8:112098114-112098136 AATAATTCAAACAAAGCTGTTGG + Intergenic
1047175323 8:122535316-122535338 GGAAATGCACATAAAGCACTTGG + Intergenic
1047827287 8:128590902-128590924 GATAATGCACATAAAGTGCTTGG + Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1051856735 9:21576038-21576060 CATAATGCATACAAATCACTCGG + Intergenic
1052172166 9:25413040-25413062 GATCATGCATACAAAGTTCTGGG - Intergenic
1053940230 9:43240484-43240506 GATAATGGAGACAGAGTTCTTGG - Intergenic
1054871683 9:70052905-70052927 GCCAATGGACAAAAAGCTCTTGG + Intronic
1055483311 9:76731779-76731801 AATAATGCAGACAAAGCTCAAGG - Intronic
1058657181 9:107233619-107233641 GATATTACACATAAAGCTCATGG - Intergenic
1058889585 9:109349603-109349625 GATAATGTGCAAAAAGCCCTTGG + Intergenic
1058936076 9:109770863-109770885 GATAATGTATACAAAGCTCCTGG - Intronic
1060193601 9:121608622-121608644 GATAGTGAACATAAAGCTGTAGG + Intronic
1060300135 9:122370251-122370273 GGGAATGCACACAAATCTCCTGG - Intergenic
1060724505 9:125998033-125998055 AATAATCCACACAGAGCTCAGGG + Intergenic
1203624219 Un_KI270749v1:155092-155114 GATAATGGAGACAGAGTTCTTGG - Intergenic
1187760269 X:22575878-22575900 AATAAGTCACACAAAGTTCTTGG - Intergenic
1188462234 X:30441892-30441914 GGTAATGGACACACAGCTCTGGG - Intergenic
1189642630 X:43089211-43089233 GATAATGGATGAAAAGCTCTCGG + Intergenic
1192103527 X:68290884-68290906 GATAGTGTACACAAAGCAGTAGG + Intronic
1193498014 X:82237900-82237922 GATAATGCTGTCAAAGCCCTGGG + Intergenic
1194753068 X:97705798-97705820 GATAATCCACGTAAAGCACTTGG + Intergenic
1196049861 X:111293244-111293266 GATAAAGAACACAAAGCACTGGG - Intergenic
1196168234 X:112558360-112558382 GACAATGTACCCAAATCTCTGGG + Intergenic
1196756033 X:119158218-119158240 GACAGTTCACCCAAAGCTCTGGG + Intergenic
1196868298 X:120088900-120088922 GATTATGCAAACATAGCTTTGGG - Intergenic
1197517090 X:127446409-127446431 GTTAATGCAGACAAATTTCTTGG - Intergenic
1197540280 X:127751063-127751085 GATGACCCACATAAAGCTCTAGG + Intergenic
1197568936 X:128125184-128125206 GATGATGCACAGAAAGCTTTTGG + Intergenic
1200603135 Y:5231427-5231449 GATAATCCAGAGAAATCTCTTGG - Intronic
1202338374 Y:23833471-23833493 GATAACGCACAAAATTCTCTCGG - Intergenic
1202532392 Y:25836600-25836622 GATAACGCACAAAATTCTCTCGG + Intergenic