ID: 1148638129

View in Genome Browser
Species Human (GRCh38)
Location 17:49164867-49164889
Sequence TGGTGCAATCACAGTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148638128_1148638129 -6 Left 1148638128 17:49164850-49164872 CCTAGGCTGGAGTGCAGTGGTGC 0: 44964
1: 130250
2: 200761
3: 192907
4: 126856
Right 1148638129 17:49164867-49164889 TGGTGCAATCACAGTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148638129 Original CRISPR TGGTGCAATCACAGTGATCA TGG Intronic
901073231 1:6534465-6534487 TGCTGCAATCACACTGACCCAGG - Intronic
901560792 1:10068709-10068731 TTGTGCAATCACAGGTATAAAGG - Intronic
901757177 1:11448535-11448557 GGGCACAATCACAGTGAGCAAGG - Intergenic
903049717 1:20591513-20591535 TGGGGATATCACAGTGAACAGGG + Intronic
904047545 1:27617536-27617558 TGCTACAATCACAGTCATCAGGG + Intronic
911160418 1:94677912-94677934 TGGTCCAATCACTGTGGCCAGGG + Intergenic
911832090 1:102563404-102563426 AGGTGCAATGTCAATGATCAAGG - Intergenic
912656801 1:111493294-111493316 TGGTGCCATCATTGTCATCATGG + Intronic
912815584 1:112825634-112825656 TGGTGCCATCACTCGGATCAGGG - Intergenic
914949165 1:152096628-152096650 TGGTGATATAACTGTGATCAAGG - Intergenic
915247762 1:154568364-154568386 TGGTGCAGGCACAGAGAGCAAGG + Intronic
921570247 1:216769265-216769287 AGCTGCAAACAGAGTGATCAGGG + Intronic
922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG + Intergenic
1063301146 10:4849927-4849949 TTGTACAATCACAGTGAGGAAGG + Intergenic
1064476077 10:15690396-15690418 TGGAGCTATGACAGTGATCCTGG - Intronic
1064960667 10:20961489-20961511 TGGTTCCATCACAGTTATCTAGG - Intronic
1065224399 10:23528213-23528235 TGATGCAATAACTCTGATCAGGG - Intergenic
1065612111 10:27482268-27482290 TGGTGCAATCATATAGCTCATGG + Intergenic
1067693646 10:48520229-48520251 AGAGGCAATCACAGTCATCAGGG + Intronic
1070499219 10:77054660-77054682 TGATGCAGTCCCAGTGATTAGGG - Intronic
1072828865 10:98636756-98636778 TGGTGAAATCCCAGTCATAAAGG - Intronic
1074438561 10:113455113-113455135 TGTTGGAATCACAGTGGTAAGGG + Intergenic
1074889158 10:117720855-117720877 TGATGCACTCACAGTGACCAGGG - Intergenic
1075812583 10:125235842-125235864 TAGATCAATCACAGTGATCAGGG - Intergenic
1078778771 11:14417602-14417624 TGGACCAATGACAGTGATCAGGG - Intergenic
1079473063 11:20798702-20798724 TGGTGCAATGACAGTGATTCTGG + Intronic
1079586390 11:22130409-22130431 AGGTGCAAGCAAAGTGATCAGGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083503450 11:63133071-63133093 TGGTGCACTAGCAGTGAGCAAGG + Intronic
1087117407 11:94540579-94540601 TGAAGCAATCACTGTGGTCAGGG - Intergenic
1087498276 11:98917962-98917984 TGGGGGAAGCACAGTGATCATGG - Intergenic
1088765932 11:112978029-112978051 TGGTGCAATCCCAGTGTGTAAGG + Intronic
1090104734 11:123840743-123840765 TGGTTCAATCATAGAGTTCAGGG + Intergenic
1092763765 12:11833848-11833870 TGGTGCCATGACAGAGATCCAGG - Intronic
1093894116 12:24558064-24558086 TGTTGCAATTACAGGTATCAAGG - Intergenic
1097786196 12:63762665-63762687 TGATGAAGTCACAGTAATCAAGG - Intergenic
1098766081 12:74490944-74490966 TGGTGCTATTACAGAGAACAAGG + Intergenic
1101521593 12:105487224-105487246 TGGTGTAATGGCAGTGATCATGG + Intergenic
1103252574 12:119513024-119513046 TGGTGTAGTCACAGTCATCAAGG + Intronic
1104004560 12:124882927-124882949 GGCTGCAATCACAGGGACCAGGG - Intergenic
1104004753 12:124884198-124884220 GGCTGCAATCACAGGGACCAGGG - Intergenic
1106860467 13:33902059-33902081 TGGTGGAATAACACTGATGACGG + Intronic
1107291952 13:38864567-38864589 TGGTGCCACCACAGTCAGCAAGG - Exonic
1109474434 13:62860344-62860366 AGATGCAATCACAGTTATTAAGG - Intergenic
1111578216 13:90187121-90187143 TCGTTCAATGACAGTGATAAAGG - Intergenic
1112254593 13:97818078-97818100 TGGTGCATTAACAGGGAGCAGGG + Intergenic
1112814603 13:103257138-103257160 TGGTGAAATCAGAGTAATTAGGG + Intergenic
1113210153 13:107968859-107968881 TGGTGCAAGTAAAGTGTTCAGGG + Intergenic
1115774388 14:36699706-36699728 TGCTGCACTAACAGTGAGCAAGG + Intronic
1116035429 14:39621444-39621466 TGGTGGCATCAAAGTGATGATGG + Intergenic
1119685489 14:76627719-76627741 TGGTCCAATCAGACTGATCGAGG - Intergenic
1120736943 14:88064057-88064079 TGGACCAATCACTGTAATCAAGG - Intergenic
1126073782 15:44888567-44888589 TGGCAGAATCACAGTGAACAAGG + Intergenic
1126084407 15:44998287-44998309 TGGCAGAATCACAGTGAACAAGG - Intergenic
1128319779 15:66685081-66685103 TGGTGCATTCACAGAGACCCAGG + Intronic
1129914448 15:79256510-79256532 TGGTGCACTCAGAGAGGTCAGGG + Intergenic
1130560470 15:84954238-84954260 TGAAGCAATCACTGTGACCAGGG + Intergenic
1131593456 15:93773270-93773292 AGGTTCAAGCACAGGGATCATGG + Intergenic
1133337502 16:5015524-5015546 TGGACCAATCACCGTGATCCAGG + Exonic
1133808961 16:9146565-9146587 TGGAGCATGCACAGTGATCCGGG + Intergenic
1134212385 16:12288617-12288639 TGGTGCCATCATAGTGATGCAGG - Intronic
1135162258 16:20107262-20107284 TGAGCCAATCACTGTGATCAGGG - Intergenic
1135741864 16:24982643-24982665 TGGACCAGTCACAGTGATGAGGG - Intronic
1137899691 16:52253451-52253473 TAAGGCAATCACTGTGATCATGG - Intergenic
1139018371 16:62717825-62717847 TGGTCCACTGAGAGTGATCAGGG + Intergenic
1141966907 16:87451820-87451842 TGGTGACACCACAGTGAACACGG + Intronic
1142905664 17:3039955-3039977 TGGTGCAACCACAGGGCTTATGG + Intergenic
1146570008 17:33944400-33944422 TGGTGCATTCCTAATGATCAAGG - Intronic
1148638129 17:49164867-49164889 TGGTGCAATCACAGTGATCATGG + Intronic
1153075211 18:1155406-1155428 TAGTGCAATCACAGTGGTGGTGG - Intergenic
1155480879 18:26286229-26286251 TGTGGCAAACACAGTGACCACGG + Exonic
1155980959 18:32178866-32178888 TGGTGCAAAAGCAGTGATAATGG + Intronic
1156601124 18:38608400-38608422 TGGTGCTATCAAAGTGAATAGGG - Intergenic
1158603373 18:58873798-58873820 TGGTGAAATCTGAGTGATAAAGG + Intronic
1160328460 18:77970507-77970529 TGGTGCAAACACCATGATCTTGG + Intergenic
1160616537 18:80134469-80134491 TGGTACTACCACAGTGATCAAGG - Intronic
1162396860 19:10422275-10422297 TGTTTCAATCACAGTGTCCAAGG - Intronic
1163622144 19:18367440-18367462 GGGTGCAGGGACAGTGATCAGGG + Exonic
1166252952 19:41584178-41584200 TGGTGCAACCACGGAGAGCAAGG + Intronic
1166261273 19:41643104-41643126 TGGTGCAATAACATTAACCAAGG - Intronic
1166966262 19:46530913-46530935 TGCCCCAATCACAGTGACCAGGG - Intronic
1167771844 19:51525650-51525672 AGGTGCCAGCAAAGTGATCAAGG - Intronic
926986584 2:18631281-18631303 TGGTGCCATCATATTTATCAGGG + Intergenic
928337393 2:30409386-30409408 GGGTGCTAACACAGGGATCAGGG - Intergenic
929202043 2:39245623-39245645 TGGTGTAATCACAGTATTAAGGG - Intergenic
929295401 2:40240825-40240847 TAGTGCAATGGCAATGATCATGG - Intronic
930100058 2:47596464-47596486 TGGTGTGGGCACAGTGATCATGG + Intergenic
932588412 2:73046624-73046646 GGGTGCAGTGGCAGTGATCATGG - Intronic
933080224 2:77976616-77976638 TGGAGGGATCACAGTGATTAGGG + Intergenic
934196817 2:89844246-89844268 TGGGGCCATCACACTGTTCAGGG - Intergenic
935675760 2:105593990-105594012 TGGGGGAATCACAGTGACAAAGG + Intergenic
936019825 2:108986420-108986442 TGGTGCAATGACAGCCACCAGGG - Intronic
939801659 2:146718983-146719005 TTGTTTAATCACAGTGATTATGG - Intergenic
941028525 2:160485240-160485262 TTGTGAAGTCACAGGGATCAGGG - Intronic
941892185 2:170594143-170594165 TGGACCAATTACAGTGATCAGGG - Intronic
942173833 2:173312162-173312184 TGGAGCACTCAGAGTGATAATGG + Intergenic
946173156 2:217907228-217907250 TGGTGCATTCTCAGTGGTGATGG + Exonic
946445581 2:219737383-219737405 TGGCACAATCACAGTGTGCAGGG + Intergenic
947445740 2:230161313-230161335 TGCTGCAACCACAGTGCTTAAGG + Intergenic
948304656 2:236937596-236937618 TGGTGGGACCAAAGTGATCAAGG - Intergenic
948304784 2:236938508-236938530 TGGTGGGAGCAAAGTGATCAAGG + Intergenic
1170556983 20:17522692-17522714 TGTAGTAATAACAGTGATCAGGG + Intronic
1171056096 20:21908476-21908498 TGGAGTAATCACTGTGATCTGGG + Intergenic
1172780189 20:37432001-37432023 TGGTGCAGGCACACTAATCATGG - Intergenic
1174188871 20:48725768-48725790 TGATCCAATGACAGTGAGCAGGG - Intronic
1175543894 20:59765725-59765747 TGCTGAAAACACAGTGGTCAGGG - Intronic
1177847294 21:26305793-26305815 TGGTGCAATCACAGTATCTAGGG - Intergenic
1178028958 21:28502949-28502971 TGGGGCATTTACAGAGATCAAGG - Intergenic
1178786038 21:35654416-35654438 TGGTGCTACCATAGTGGTCATGG - Intronic
1183044607 22:35209791-35209813 TGTTGCATTCACAGTAATCTAGG + Intergenic
1185208748 22:49554947-49554969 GGGTGCACCCACGGTGATCAGGG + Intronic
949450027 3:4174919-4174941 TGCTGCAATAGCAGTGAGCAAGG - Intronic
950157102 3:10729774-10729796 TGCTGCATTCACACTGATCATGG - Intergenic
951369210 3:21824828-21824850 TGGTGTAAAAACAGTCATCAAGG - Intronic
951469100 3:23036189-23036211 TGCTGCAATAGCAGTGAGCAAGG + Intergenic
955162296 3:56476128-56476150 TGGAGCAATCACTGTGGCCAAGG - Intergenic
959522031 3:107332149-107332171 TGGAGCAATCAGGGTGATAAAGG - Intergenic
968324417 3:197800136-197800158 TGGTGCGATCAGCGTGATCTTGG - Intronic
972712241 4:41609058-41609080 TGAAGCAGTCACTGTGATCAGGG + Intronic
973240617 4:47952627-47952649 TGGTACAATCACATTGGGCATGG + Exonic
974010076 4:56598667-56598689 GGCTGGAATCACAGGGATCAAGG + Intronic
975124688 4:70768435-70768457 TGGTTGAATCATAGTCATCATGG - Intronic
975408506 4:74020508-74020530 TGAGTCAATCACTGTGATCAGGG + Intergenic
976140505 4:81986655-81986677 TGGACCAATCACAGTGGCCAAGG - Intronic
976557835 4:86469186-86469208 TGGTGCGATCATAGGGCTCAAGG - Intronic
976826690 4:89268435-89268457 TGGTTCAAGCACAGGGAACAAGG + Intronic
978003741 4:103590906-103590928 TGAAGAAATCACAGTGGTCAAGG - Intronic
979704722 4:123708667-123708689 TGGGGCACTCACAGTATTCAGGG - Intergenic
979758735 4:124373943-124373965 AGGTGCAAGCAAAGCGATCAGGG + Intergenic
982992276 4:162291522-162291544 TGGTGGAAATACAGTGAACAGGG + Intergenic
983741941 4:171145950-171145972 TGGTGCAATAATATTAATCATGG + Intergenic
984090816 4:175373174-175373196 TGGAGCAGTGGCAGTGATCATGG - Intergenic
984536168 4:180978250-180978272 TGGTGCAATCACTTTGATGGGGG + Intergenic
988309738 5:29541934-29541956 TGTTGCACTAGCAGTGATCAAGG + Intergenic
988681480 5:33488559-33488581 TTGTGTAAGTACAGTGATCAAGG - Intergenic
989305503 5:39950926-39950948 TGGCGCAACCACAGAGAGCAAGG + Intergenic
990349374 5:54900301-54900323 TGGTGCTATTACAGAGATGAAGG - Intergenic
995000369 5:107120616-107120638 TGGTGCAAACACAATGAAGACGG - Intergenic
995544133 5:113213421-113213443 TGGTGGTCTCACAGTGTTCATGG + Intronic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
1001540314 5:172533264-172533286 TGGTCCAATCACAGGGAGCTCGG + Intergenic
1001593465 5:172882261-172882283 TGGGGAAATGAAAGTGATCAAGG - Intronic
1003725757 6:8761295-8761317 TGGTGAGAGCACAGTGATCTCGG + Intergenic
1004006281 6:11640140-11640162 TGGTGCAGTTAAAATGATCAGGG + Intergenic
1005005062 6:21279687-21279709 GTGTGCAATCACAGTGGTCGAGG + Intergenic
1007222884 6:40293162-40293184 TGGGGAAATCACAGTGAAGAAGG - Intergenic
1011118852 6:83927650-83927672 TGATGCAATCACTGAGGTCATGG - Intronic
1011292103 6:85787864-85787886 TGCTGCACTAACAGTGAACAAGG + Intergenic
1012209283 6:96500063-96500085 TGCTGCACTGACAGTGAGCAAGG + Intergenic
1017072899 6:150592097-150592119 TGGTCCAACCACAGGGATCTGGG - Intergenic
1017279639 6:152609357-152609379 TGGTGCACTAGCAGTGAGCAAGG - Intronic
1017874721 6:158515154-158515176 TGCTGCTGTCACAGTGAGCATGG - Intergenic
1019004052 6:168781387-168781409 TGATGTGATCGCAGTGATCACGG - Intergenic
1019522024 7:1465345-1465367 TGGTGCTATCTCAGTGATCTCGG + Intergenic
1020854749 7:13404863-13404885 TGGTGTAAGGACTGTGATCATGG + Intergenic
1022178162 7:27892493-27892515 TGGGGCAGTCACAGTTATCTGGG + Intronic
1024210753 7:47201392-47201414 TGGTGCATTCACAGTGATGGTGG - Intergenic
1025807817 7:64852442-64852464 TGGTGCAATCTCGATGATCAGGG + Intergenic
1026372847 7:69718950-69718972 TTGTACAATCCCAGTGTTCAAGG + Intronic
1028798228 7:94929770-94929792 TGCAGCAGTCACAGTGAACACGG + Intronic
1029155451 7:98514314-98514336 TGGACCAATCACAGTCACCAAGG - Intergenic
1030831449 7:114227217-114227239 TGGTGGAATCATTGTGAGCATGG + Intronic
1031702852 7:124946158-124946180 TAATGCAATCACAGTAATAATGG + Intergenic
1036679760 8:10863414-10863436 TGGTGCATTCTCACTTATCAGGG - Intergenic
1041490197 8:58424863-58424885 TGGTGCAGTCTCAGAGGTCAGGG - Intronic
1042977979 8:74492151-74492173 TGCTGGCTTCACAGTGATCAAGG + Intergenic
1043229802 8:77787887-77787909 TGGGGCAATCTCAGTGATTATGG + Intergenic
1043629410 8:82309799-82309821 TGGTGCTATTTCAATGATCAAGG - Intergenic
1044809065 8:96038873-96038895 TGCTGCACTCACAGTGAGCAAGG + Intergenic
1045001522 8:97882441-97882463 GGGTGCAGTGGCAGTGATCATGG + Intronic
1048376306 8:133825561-133825583 TGTTGCAATCAGAGAGATGAAGG - Intergenic
1050230351 9:3517657-3517679 TTGTGCAAACACAGTGTTTATGG + Intronic
1050363149 9:4850372-4850394 TGGTGCCATCACATTGAGAAAGG + Intronic
1050573757 9:6970350-6970372 AGGTACAATTACAGTGACCAAGG - Intronic
1057196710 9:93119653-93119675 TGGGGCCAAGACAGTGATCAGGG + Intergenic
1057806957 9:98226241-98226263 TGGGGCCATAGCAGTGATCAGGG - Intronic
1187729224 X:22235646-22235668 TAATGCCATCACATTGATCAGGG + Intronic
1188552389 X:31378176-31378198 TGGTGCCATCACTCGGATCAGGG + Intronic
1188717399 X:33476846-33476868 AGGTGCAAGCAAAGTAATCAGGG - Intergenic
1190632577 X:52401943-52401965 TTGTGAAATCACACTGATCCAGG + Intergenic
1191750358 X:64535754-64535776 AGGAGCAGTAACAGTGATCATGG + Intergenic
1193063680 X:77233985-77234007 CAGTGCAATCATAGTGATGATGG + Intergenic
1193513368 X:82433202-82433224 AGGTGCAAGCAAAGTGATCAAGG - Intergenic
1195942601 X:110178256-110178278 AGGGCCAATCACAGTCATCATGG - Intronic
1196871950 X:120120864-120120886 TGATACAATCACTGAGATCACGG - Intergenic