ID: 1148638825

View in Genome Browser
Species Human (GRCh38)
Location 17:49169661-49169683
Sequence CTTGAACTGGACCCGGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148638825_1148638835 25 Left 1148638825 17:49169661-49169683 CCCTCACCCGGGTCCAGTTCAAG 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1148638835 17:49169709-49169731 ATCTCCAATGTGCCGCATAAAGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148638825 Original CRISPR CTTGAACTGGACCCGGGTGA GGG (reversed) Exonic
906244287 1:44262276-44262298 CTTGAACTGGGCCTCTGTGAAGG - Intronic
919785345 1:201254918-201254940 CTGCACCTGGCCCCGGGTGAGGG + Intergenic
923025377 1:230199749-230199771 CTTCAACAGGACCCTGGTGTGGG - Intronic
923587808 1:235290756-235290778 CTTAAACTGGACTGTGGTGATGG + Intronic
924513487 1:244747687-244747709 CTTGAACTGAACCCGGGAGATGG - Intergenic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1063409487 10:5826032-5826054 CTTGAACTGAACCTGGGAGGCGG + Intronic
1071790752 10:88951696-88951718 TTGGAACTGCACCCGGGTCAGGG + Intronic
1073103892 10:101021440-101021462 TTTGGACAGGACCTGGGTGATGG - Intronic
1074112070 10:110429776-110429798 TTTGAGCTGGACCCTGGTGGAGG - Intergenic
1074577531 10:114684468-114684490 GCTGAACTGGACCCGAGGGAGGG + Intronic
1089653814 11:119932830-119932852 CTCTAACTGCACCCAGGTGAGGG + Intergenic
1090535156 11:127632887-127632909 CTTGAACTGGCCATGGGAGAGGG - Intergenic
1091340625 11:134809970-134809992 CTGGAACTGCACCCAGCTGAAGG + Intergenic
1091692208 12:2605070-2605092 ATTGCACTGGACCTGGGAGAGGG - Exonic
1091716741 12:2783155-2783177 ATTGAACTGGACCAGTGTGGTGG + Intergenic
1095684030 12:45011882-45011904 CTTGAGGTGGACCAGGGTGTGGG - Intergenic
1098082933 12:66808797-66808819 ATTGAATTGGACCCTGGGGAGGG - Intergenic
1104016539 12:124965682-124965704 CTCGATCTGGACCTGGGGGATGG - Exonic
1107995098 13:45851451-45851473 CTTGAACCTGAGCCCGGTGAAGG + Intronic
1112297759 13:98203327-98203349 CTGAAACTGGACCGTGGTGATGG - Intronic
1117010113 14:51462440-51462462 CTTGAACTGGCTCCTGGTGTAGG + Intergenic
1118108718 14:62691877-62691899 CTAGAACTGGATCATGGTGATGG + Intergenic
1124342569 15:28899658-28899680 CTTGGACTGGACACGCGTGCAGG + Intronic
1125149662 15:36517438-36517460 CTTGAACTGGGCTCAAGTGATGG - Intergenic
1130567337 15:85007986-85008008 CTTGACCTTGCCCAGGGTGATGG + Intronic
1131582454 15:93658084-93658106 CTTGAAATGAACCCAGCTGAGGG + Intergenic
1133372995 16:5259739-5259761 CCTGAAATGGAGCCGGGTTATGG + Intergenic
1135008191 16:18847296-18847318 CTGGAAATGGACCGTGGTGATGG + Intronic
1135015008 16:18917971-18917993 CTTGAACTGGGCCAGGGTGGTGG + Intronic
1136332107 16:29586943-29586965 CTTAAACTGGGCCAGGGTGGTGG + Intergenic
1136446803 16:30327009-30327031 CTTAAACTGGGCCAGGGTGGTGG + Intergenic
1137751974 16:50870263-50870285 CTTGAACTAGATCATGGTGATGG - Intergenic
1140055693 16:71523617-71523639 CTTGAGCTGGGCCCTGGTGGTGG - Intronic
1145785685 17:27592476-27592498 CTTGACCTGTTCCCTGGTGATGG + Intronic
1145899065 17:28478183-28478205 TTTGAACTGGAACCTGGTGTTGG + Intronic
1146196983 17:30821815-30821837 CTTGAATTAGACACTGGTGATGG + Intronic
1146629707 17:34460949-34460971 CTATGACTGGACCCCGGTGAGGG - Intergenic
1148638825 17:49169661-49169683 CTTGAACTGGACCCGGGTGAGGG - Exonic
1148772757 17:50076573-50076595 CTGGAACTGGACCTGGGGGGTGG - Exonic
1149628873 17:58103433-58103455 CTTGAACCGGACCCGGGAGGTGG - Intergenic
1150448863 17:65248997-65249019 CTTGAACAGCACCGGGGTTAGGG - Intergenic
1151659333 17:75510272-75510294 CCTGAAGAGGACCCGGGTGGGGG + Intronic
1153062428 18:1007833-1007855 CATGAACTGGACCTGGGTCAGGG + Intergenic
1153639805 18:7146989-7147011 CTTGAACTGGGCCCAGTTGGTGG - Intergenic
1156739739 18:40309726-40309748 CTTGAGTAGGACACGGGTGAGGG + Intergenic
1160688246 19:447371-447393 CTGGAACTAGACACGGGTGAGGG + Intronic
1160780273 19:874582-874604 CCTGCACAGGACCCGGGTGCCGG + Intronic
1162403386 19:10459512-10459534 CTGGGAGTGGGCCCGGGTGAGGG + Intronic
1163574906 19:18105001-18105023 ATTGAACTGGACCCAGGTCTGGG + Intronic
1164159185 19:22615656-22615678 ATAGAACTGGATCAGGGTGAAGG + Intergenic
1165155175 19:33782481-33782503 CTTGTGCTAGACCTGGGTGATGG + Intergenic
1168384038 19:55948111-55948133 CTCGACCTGGTCCCAGGTGATGG - Exonic
925218359 2:2116829-2116851 CTTGAAGTGGAGCCAGGTGAGGG - Intronic
928666955 2:33558983-33559005 TTTGAACTTGACCAGGATGAAGG + Exonic
931295595 2:60921840-60921862 CTTGAGATGGGCCCAGGTGAGGG - Exonic
933159574 2:79009173-79009195 GTTGACCTGGACCAGGATGATGG + Intergenic
941825978 2:169897583-169897605 CTTGAACTGAACCCAGGAGGCGG - Intronic
944365940 2:198919678-198919700 CTTGAAATGGTCCTGGGTCATGG + Intergenic
948351037 2:237341008-237341030 ATTGAACTGGAACAGGGTGGTGG + Exonic
948785290 2:240349132-240349154 CTGGAGCTGGACGCTGGTGAAGG + Intergenic
1168813594 20:721842-721864 CTTGAACAGAACCAGGGTCATGG - Intergenic
1169664510 20:8019460-8019482 CTCCAACTGGACGCTGGTGATGG - Exonic
1177283393 21:19014682-19014704 CTTGTAATGGACCAGGCTGATGG + Intergenic
1180172025 21:46064586-46064608 CTGGAACTGGACCGAGGTGGGGG + Intergenic
1181796958 22:25318280-25318302 CCTGGACTGGCCCCGGGTGCTGG + Intergenic
1182322120 22:29484558-29484580 CTTCAACTGAACCTGGGAGATGG + Intronic
1183460529 22:37947294-37947316 CTTGAACTGCTCCCGGCTGTAGG + Exonic
950474880 3:13208916-13208938 TTTGAACTGGCCCCTGGTCAGGG - Intergenic
959348178 3:105225944-105225966 CTTGAACTTGACCCGGGAGGTGG + Intergenic
963608296 3:147433315-147433337 CTTGAACTAAAACAGGGTGACGG + Intronic
968598712 4:1499009-1499031 CTGCACCTGGACCTGGGTGAAGG + Intergenic
974127098 4:57709869-57709891 CCTGGACAGGACTCGGGTGATGG + Intergenic
981431215 4:144663205-144663227 CTTGAACTGAACCTGGGAGGCGG + Intronic
984882520 4:184422869-184422891 CTGGAACTGGACAGTGGTGATGG + Intronic
987071600 5:14342140-14342162 CTTGCACTGGGGCCGGGGGAGGG + Intronic
990781558 5:59370100-59370122 AGTGACTTGGACCCGGGTGATGG - Intronic
995373386 5:111445944-111445966 CTGGAACTGGATCTGGGGGAAGG + Intronic
997583090 5:135029310-135029332 CTTGAACCAGACCTGGGGGAGGG + Exonic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
1000210762 5:159104526-159104548 CCTGAACTGCACCCGGAAGATGG + Intergenic
1000816331 5:165927137-165927159 CTGGAGCTGGAGCAGGGTGAGGG - Intergenic
1007147191 6:39647791-39647813 CTTGAACTGAACCCGGGAGGCGG - Intronic
1011884488 6:92077115-92077137 TTTAAACTGAACCTGGGTGATGG - Intergenic
1013287007 6:108690505-108690527 CATGAAGTGGACCAGGGAGAGGG - Intergenic
1018593236 6:165451275-165451297 CTTGAACTGGAGCAGGGTGGGGG - Intronic
1024514093 7:50229408-50229430 CCTGAACTGGAACTTGGTGATGG + Intergenic
1034271227 7:149804222-149804244 CTTGAACTGGCCTCGGTGGAGGG + Intergenic
1036397142 8:8379011-8379033 TCTGAACTGGATCAGGGTGAGGG + Intronic
1036397155 8:8379069-8379091 TCTGAACTGGATCAGGGTGAGGG + Intronic
1040106934 8:43546723-43546745 CATGAAGTCGCCCCGGGTGACGG - Intergenic
1042779545 8:72475717-72475739 CTTGCACTGGAGTCGGGTAAGGG + Intergenic
1043494905 8:80790310-80790332 CCTGAACTGGACCTTGGTTATGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1059441440 9:114309270-114309292 ATTCATCTGGACCCGGCTGATGG - Exonic
1062541414 9:137043289-137043311 CTGGAAGTGGACCCTGGGGAGGG - Intronic
1186463219 X:9765142-9765164 CTTGATCGGTGCCCGGGTGATGG - Intronic
1200091366 X:153637626-153637648 CTTGAACTCCACCCTGGTGGGGG + Intergenic
1200117402 X:153775410-153775432 CTTGACCTGGACCCGGTGGCGGG + Intronic
1200940394 Y:8774350-8774372 CTTGAACTGGCCTCGTGTGTGGG + Intergenic