ID: 1148641656

View in Genome Browser
Species Human (GRCh38)
Location 17:49192473-49192495
Sequence CAAGCTAGGAGGGCTCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148641656_1148641662 -10 Left 1148641656 17:49192473-49192495 CCGCCCAGAGCCCTCCTAGCTTG No data
Right 1148641662 17:49192486-49192508 TCCTAGCTTGAGGAGACTCGCGG No data
1148641656_1148641667 19 Left 1148641656 17:49192473-49192495 CCGCCCAGAGCCCTCCTAGCTTG No data
Right 1148641667 17:49192515-49192537 TAAGAAGCCAGCAGGTCCCATGG No data
1148641656_1148641664 11 Left 1148641656 17:49192473-49192495 CCGCCCAGAGCCCTCCTAGCTTG No data
Right 1148641664 17:49192507-49192529 GGCCGCCTTAAGAAGCCAGCAGG No data
1148641656_1148641669 27 Left 1148641656 17:49192473-49192495 CCGCCCAGAGCCCTCCTAGCTTG No data
Right 1148641669 17:49192523-49192545 CAGCAGGTCCCATGGTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148641656 Original CRISPR CAAGCTAGGAGGGCTCTGGG CGG (reversed) Intergenic
No off target data available for this crispr