ID: 1148643345

View in Genome Browser
Species Human (GRCh38)
Location 17:49204588-49204610
Sequence CAGAATGGTGAGATGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148643337_1148643345 27 Left 1148643337 17:49204538-49204560 CCTTCTCTTGAGCAGAGTATATG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG 0: 1
1: 0
2: 2
3: 24
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148643345 Original CRISPR CAGAATGGTGAGATGGAGTC AGG Intronic
900129195 1:1080449-1080471 CAGAATTGAGAGATGGGGCCTGG + Intergenic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
903780078 1:25815365-25815387 CAGGGTGATGAGATGGTGTCGGG + Intronic
904412219 1:30331344-30331366 CAGAAAGGGGTGAGGGAGTCAGG - Intergenic
904521995 1:31102785-31102807 CAGTATGGGGAGGTGGAGTCAGG - Intergenic
905826632 1:41030537-41030559 CCAAATGTTGAGAAGGAGTCAGG - Intronic
906748329 1:48237161-48237183 CAGTTTGTTGAGAAGGAGTCAGG + Intronic
908399618 1:63758870-63758892 CAGAATGTAGATATGCAGTCAGG - Intergenic
909353292 1:74678554-74678576 CAGAATGGTGAGAAATAATCAGG - Intergenic
910243709 1:85116064-85116086 CAGCAAGGTGAAATGGAGCCAGG - Intronic
910922349 1:92362419-92362441 CAGAATGGTGAAAAAGAGCCTGG + Intronic
912156620 1:106929013-106929035 CAGAAAGAGGAGATGGATTCAGG + Intergenic
913698111 1:121347572-121347594 CAGCAAGTTGAGATGGGGTCAGG - Intronic
914139439 1:144932480-144932502 CAGCAAGTTGAGATGGGGTCAGG + Intronic
917296892 1:173529342-173529364 CAGACTGGTGCGAGGGAGCCTGG + Intronic
917632558 1:176904457-176904479 CAGCATGGGGAGAGGGAGTGCGG + Intronic
918276860 1:182960998-182961020 CAGAATGCGGGGATGGAGTAAGG + Intergenic
920485506 1:206366222-206366244 CAGCAAGTTGAGATGGGGTCAGG - Intronic
924474417 1:244370766-244370788 CAGAATAGCGACATGGAGTTTGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063673743 10:8121195-8121217 CCAAAAGGTGAGAAGGAGTCAGG - Intergenic
1064441026 10:15353868-15353890 CAGAATGGAGTGTTGGAGTCAGG - Intronic
1065876523 10:30001863-30001885 CAGAGTGGTGAGCAGGACTCAGG + Intergenic
1066537952 10:36411792-36411814 CACATTGGTGAGATGGACTGTGG - Intergenic
1066644897 10:37596442-37596464 CACACTGGTGAGATGGAATGTGG - Intergenic
1071371041 10:84952247-84952269 CTAAATGGAGAGATGGGGTCTGG + Intergenic
1072941632 10:99769585-99769607 GAGAAGGGAGAGATGAAGTCTGG - Intergenic
1073032465 10:100537772-100537794 CAGACTGCTGATAAGGAGTCAGG - Intronic
1073110323 10:101059507-101059529 CAGAATGATGAGCTGGAGTGTGG - Intergenic
1073695870 10:105866733-105866755 AAGAAAGGTAAGATGCAGTCAGG - Intergenic
1074428013 10:113369069-113369091 CAGAAAGGTGGGCTGGAGTTGGG + Intergenic
1076563492 10:131382471-131382493 CAGGATGGTGAGAGGGAGGGAGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079104251 11:17560356-17560378 CAGAATGGGGAGAGGTTGTCAGG + Intronic
1085170040 11:74442072-74442094 CAAAAGTGTGAGATGGAGCCAGG + Intergenic
1085822236 11:79805295-79805317 CAGAAGGGTGAGAGTGAGTAGGG + Intergenic
1087448919 11:98292523-98292545 CATTATGGGGAGATGGAGTTTGG - Intergenic
1088799348 11:113291058-113291080 CAGAATGATGGGATAGAGTGAGG + Intergenic
1089195502 11:116692087-116692109 GAAAAGGATGAGATGGAGTCAGG - Intergenic
1089358350 11:117870340-117870362 CAGCAGGGCGTGATGGAGTCAGG + Intronic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1090237181 11:125158015-125158037 CAGAATGGTGGTTTGGAGTGTGG + Intergenic
1090249277 11:125240143-125240165 CGGAAGAGTGAGATGGAGTGGGG + Intronic
1090650067 11:128798783-128798805 TAGAATGGTGGGATGTAGTGAGG + Intronic
1090667156 11:128922103-128922125 CAGAATGGAGACATGAGGTCAGG + Intergenic
1090986482 11:131771184-131771206 CTTTATGGTGAGATGGAGGCAGG - Intronic
1091254556 11:134172409-134172431 CGGAATGGGGTGAGGGAGTCAGG - Intronic
1091611990 12:2018507-2018529 TAGAATGTTGAGAGGCAGTCAGG + Intronic
1091678788 12:2511255-2511277 CTTTATGGTGAGATGGAGTTGGG - Intronic
1092938928 12:13389719-13389741 CAGGGTGGTGAGATGGTTTCAGG - Intergenic
1094719604 12:33050423-33050445 CATAATTGTGAGATGAACTCTGG - Intergenic
1095461528 12:42449409-42449431 CTGCATGGTGAGATGAAGTGAGG - Intronic
1096528498 12:52228768-52228790 CAGCATGGTGAGAAGGTCTCTGG + Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098392330 12:69982692-69982714 CACCATGATGAGAAGGAGTCTGG - Intergenic
1098860603 12:75705849-75705871 CAGAATGGGGAAATGGAATGAGG - Intergenic
1101323132 12:103691142-103691164 CAGAATTCTGTGAGGGAGTCTGG + Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1104147655 12:126050947-126050969 CTGAATGATGAGAAGGATTCGGG - Intergenic
1104199725 12:126576918-126576940 CAGGATGCTGAGATGAGGTCTGG + Intergenic
1104443452 12:128814132-128814154 CAGAATGGCGAGATGCACTGAGG - Intronic
1105208949 13:18246723-18246745 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1106602902 13:31202322-31202344 CAGAATGAGAAGATTGAGTCAGG + Intronic
1107591060 13:41906314-41906336 CAGAAGTGTGAGTTGGAGTCTGG - Intronic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1108214313 13:48169086-48169108 AAGAATGGAGACATGGAGACTGG + Intergenic
1109974959 13:69819203-69819225 AAGAATGATGAGATGAATTCAGG + Intronic
1110526385 13:76543233-76543255 CATCATGGTGATATGGAGTGGGG - Intergenic
1111802950 13:93002640-93002662 CAAAATTCTGAAATGGAGTCTGG - Intergenic
1117330600 14:54708157-54708179 TAGAAGGGTGAGAAGAAGTCAGG + Intronic
1119683568 14:76611857-76611879 CAGAATGGAGAGGTGAAGTCAGG + Intergenic
1119772236 14:77227435-77227457 CAAAATGATGAGATGTAGTCAGG + Intronic
1119778905 14:77265390-77265412 CAGGATGGGAGGATGGAGTCAGG - Intergenic
1119832485 14:77716018-77716040 AAGAATGGTGGGGTGGAGGCTGG + Intronic
1120146495 14:80984563-80984585 GAGTATGGTGAGATGGGTTCTGG - Intronic
1121857479 14:97283326-97283348 GAGAATGGGGAGATCGAGACGGG - Intergenic
1124142925 15:27093206-27093228 CAGGTTGGTGAGGTGGAGGCAGG + Intronic
1124395029 15:29293763-29293785 CTTAATGGAGAGATGGAGTGTGG + Intronic
1125710701 15:41783452-41783474 CAGCATGGCCACATGGAGTCAGG - Intronic
1126336053 15:47587322-47587344 CAGAAATGTAAGATGGAGCCAGG - Intronic
1126525598 15:49650856-49650878 AGGAATGCTGAGATGGAGTTTGG - Exonic
1128026825 15:64444911-64444933 CAGAATGTTGAGGTGAAATCTGG + Intronic
1128127261 15:65202260-65202282 CAGATTGGTGAGATGGGGTGGGG - Intronic
1129140377 15:73592477-73592499 CAGAATGGCAAGGTGGAGCCTGG - Intronic
1129926225 15:79366649-79366671 GATAATGGTGAGATGGAGCAGGG - Intronic
1130603599 15:85295353-85295375 CAGAATGTTGGCATGGAGTGGGG - Intergenic
1131572882 15:93556899-93556921 CAGAAAGGTGGGAGGGTGTCAGG - Intergenic
1131911695 15:97212371-97212393 CAGACTGGAGAGATGGTGTCTGG - Intergenic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1137892174 16:52174327-52174349 AAGAATGGGAAGATGGAGTGGGG + Intergenic
1138224205 16:55278652-55278674 CAGAATGGTTAGAGGAAGTCTGG + Intergenic
1138990997 16:62391209-62391231 CAGGATGATGACAAGGAGTCAGG - Intergenic
1139436168 16:66937839-66937861 CAGCCTGGTGGGATGGAGACAGG + Intronic
1141783008 16:86176936-86176958 CAGAATGGTAAGAGAGAATCTGG + Intergenic
1142891842 17:2948814-2948836 CAGGGTGGTGAGATGGAGAGAGG + Intronic
1143967991 17:10770647-10770669 CAGAATGGAAAGATGGATTCGGG - Intergenic
1144590591 17:16520583-16520605 CACAGTGGTGAGATGCAGTGAGG - Intergenic
1144835132 17:18152830-18152852 ATGAATGGTGAGAAGGAGCCAGG - Intronic
1145816188 17:27796729-27796751 CAGTGTGGGGAGCTGGAGTCAGG + Intronic
1146187085 17:30731244-30731266 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146332120 17:31936604-31936626 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146593244 17:34146887-34146909 CAGAATGATGAGCTTCAGTCAGG + Intronic
1147258534 17:39196043-39196065 CAGAATGGGGAGAGTGAGTGAGG + Intronic
1147334159 17:39716671-39716693 CAGGATGGCGAGATGCAGTAGGG + Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1151756682 17:76079281-76079303 CAGGAAGGTGAGATGGAGCAGGG - Exonic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1152042723 17:77915007-77915029 CAGGATGGTGAGGGGGAGTGGGG - Intergenic
1156382628 18:36578028-36578050 CAACATGGTCAGATGGAGTGGGG + Intronic
1157026145 18:43846304-43846326 CAGGATGTTGTGATGGAGTCTGG - Intergenic
1158343056 18:56487227-56487249 CAAAGAGGTGGGATGGAGTCAGG + Intergenic
1158507403 18:58058784-58058806 CAGAAAGGTGCTATTGAGTCTGG - Intronic
1160881816 19:1324438-1324460 CAGAAGGGCGAGAAGGAGCCAGG + Intergenic
1163267545 19:16230063-16230085 CAGCATGGTGAGCTGTAGACGGG + Intronic
1164816720 19:31209851-31209873 CAGAATGGGGAGAAGGGGTTGGG - Intergenic
1165778332 19:38417914-38417936 CAGAAGGGCGAGAAGGTGTCCGG + Intronic
925724746 2:6862002-6862024 GAGAATTGTGAGATGGGCTCTGG - Intronic
925735222 2:6958008-6958030 CAGAATGGGGTGGGGGAGTCGGG + Intronic
926910068 2:17844343-17844365 AAGCATGGTCAGATGGAGTTTGG - Intergenic
929200887 2:39234453-39234475 CAGAAAGTTGAAATGGAGACAGG + Intergenic
930576033 2:53149879-53149901 CAGAATGATGAGATGAATTAAGG + Intergenic
930610773 2:53540601-53540623 GAAGATGGTGAGATGGAGACTGG + Intronic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
932573363 2:72949951-72949973 CAGGATGGCCACATGGAGTCTGG + Intronic
937394848 2:121525782-121525804 CAGACTGTTGAGATGCATTCTGG - Intronic
938172844 2:129096810-129096832 CAAAATGGTGAGATGGGGCCGGG - Intergenic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939994250 2:148905683-148905705 GAGAAGGGAGAGATGGAGCCAGG + Intronic
940659916 2:156533439-156533461 CTGAATGGTGAGACGCAGGCTGG - Intronic
940802208 2:158145216-158145238 CAGAGGGGTGAAATGGACTCTGG - Intergenic
942182031 2:173389372-173389394 CAGCATGGTAAGATGCAGTTTGG + Intergenic
944491024 2:200257963-200257985 CAGAAAGGTGAAAGGCAGTCGGG + Intergenic
944695748 2:202198956-202198978 CATAATTTTGAAATGGAGTCAGG - Intergenic
945258289 2:207820620-207820642 AGGAATGGTGAAATGGAATCAGG + Intergenic
946196407 2:218035052-218035074 CAGAATGGTGAGATGGGGGATGG - Intronic
946200665 2:218069106-218069128 CAGAATGGTGAGATGGGGGATGG - Intronic
946489107 2:220130663-220130685 CACAATGGTGAGATGCAGCCTGG + Intergenic
947763316 2:232619733-232619755 CAAAATGGTGAATTGGAGCCTGG + Intronic
948079686 2:235195637-235195659 CAGAATGGTGGGATGGAGCCAGG - Intergenic
948258912 2:236588840-236588862 CAACATGGTGAGAAGGATTCTGG + Intergenic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
949024746 2:241761731-241761753 CAGGATGGTGACATGGTGACAGG - Intronic
1169391223 20:5192868-5192890 CAGGATAGTGTGGTGGAGTCAGG + Exonic
1169989228 20:11482058-11482080 CTGAAAGGTAAGATGGAGCCAGG + Intergenic
1171320415 20:24238923-24238945 CAGACTGGAGACCTGGAGTCGGG - Intergenic
1172111530 20:32548169-32548191 AAGACAGGTGGGATGGAGTCAGG + Intronic
1173034464 20:39395510-39395532 CAGACTGGTGGGATGAAGCCAGG + Intergenic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1176884943 21:14244277-14244299 CACAATGGTGAGATGAAGAAAGG - Intergenic
1177209838 21:18057438-18057460 CAGAATGTTGATATGGAATGAGG - Intronic
1177416931 21:20806181-20806203 CAGAAAGGTGAAATGGAGTCAGG - Intergenic
1177463018 21:21437562-21437584 CAAAATGGGGAGATGAAGTGGGG - Intronic
1179167698 21:38947592-38947614 CAGAAAGGAGAGATGGAGGGAGG - Intergenic
1180182026 21:46122287-46122309 CAGAGTGGTGAGAAGGCTTCGGG + Intronic
1180723367 22:17926220-17926242 GAGGATGGTGAAATGGACTCAGG - Intronic
1180767309 22:18352575-18352597 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1180779000 22:18509804-18509826 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180811721 22:18767124-18767146 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1181197874 22:21201366-21201388 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1181672851 22:24433842-24433864 CAGCATGGTGAGCTGGCGACGGG + Intronic
1181703825 22:24635534-24635556 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1182267056 22:29125260-29125282 CAGTTTGCTGGGATGGAGTCAGG + Exonic
1182483759 22:30626924-30626946 CAGAGTGGAGAGCTGGGGTCAGG - Exonic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182937604 22:34240465-34240487 CAGCTTGCTGAGATGGATTCAGG + Intergenic
1183113464 22:35670293-35670315 CACAATGGTGACCTGGATTCAGG + Intergenic
1183483659 22:38078064-38078086 CAGGGTGGTGGGAGGGAGTCTGG - Intergenic
1183779354 22:39988855-39988877 CATGCTGGTGAGATGGAGGCTGG + Intergenic
1184197444 22:42939649-42939671 CACAATGGAAGGATGGAGTCAGG + Intronic
1184826610 22:46956929-46956951 CAGAAGGGTGTGTGGGAGTCGGG + Intronic
1184922447 22:47615074-47615096 CTCAGTGGTGAGATGGAGACCGG - Intergenic
1185071697 22:48660081-48660103 TAGAAGGGTGAACTGGAGTCTGG - Intronic
1203228931 22_KI270731v1_random:93469-93491 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
950519064 3:13485476-13485498 CAGAATGGTGTGATTGAACCAGG + Intronic
951300202 3:20987063-20987085 CTAAGGGGTGAGATGGAGTCAGG + Intergenic
951303546 3:21028489-21028511 CAGCAAAGTGAGATGGAGTCTGG + Intergenic
952303741 3:32127139-32127161 CAAATTGATGAGATGGAGTAGGG - Intronic
952917609 3:38260923-38260945 CAGAATGGTCAGAAAGAATCTGG + Intergenic
953480946 3:43251737-43251759 GAGAATGCTGAGATAGCGTCAGG - Intergenic
955034346 3:55251734-55251756 CAGAATGTTCACATGGGGTCTGG - Intergenic
956151966 3:66253109-66253131 AAGAATGTTGAGATGGGGGCCGG + Intronic
956824643 3:72986615-72986637 CAGAATGCTGGGATGGATACAGG - Intronic
957264170 3:77939911-77939933 CAGAATGATGAGTTGGAGGAAGG + Intergenic
957712625 3:83882425-83882447 CAGAAAGGTGATTTAGAGTCAGG + Intergenic
960247604 3:115416729-115416751 CACAGAGGTGAGATGCAGTCTGG + Intergenic
968776648 4:2545436-2545458 TAGAATGGTGAGATGAATTGTGG - Intronic
969226563 4:5802340-5802362 TAGGATACTGAGATGGAGTCAGG + Intronic
969281919 4:6176563-6176585 CAGAATGGGGCAATGGGGTCAGG + Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969355216 4:6621069-6621091 CAGGAGGGTGAGAGGGAGGCTGG + Intronic
970676067 4:18451743-18451765 TAGAAGGGTGAGATGGATTTTGG + Intergenic
971549371 4:27930226-27930248 CAGGATGGTAAGAAGGAGTTAGG + Intergenic
975124003 4:70761361-70761383 AAGAATGGTCAGGAGGAGTCTGG + Intronic
975447083 4:74478485-74478507 CAAAATGATGAGATGATGTCAGG + Intergenic
976478719 4:85514143-85514165 TAGAATAGAAAGATGGAGTCTGG - Intronic
978015457 4:103739362-103739384 CAGATTGTTGAGATGCAGTGGGG + Intergenic
979235661 4:118397435-118397457 GAGAATTGTGAGGTGGAGTGGGG - Intergenic
984273910 4:177584175-177584197 CAGAATGGTGAGATTGACATAGG - Intergenic
985355606 4:189116131-189116153 GAAAATGGTGAGAAGGAGGCAGG + Intergenic
987704083 5:21441576-21441598 CAGTATGGTGATTTGAAGTCAGG + Intergenic
988008022 5:25444958-25444980 TAGAATGGAGAGATTTAGTCAGG - Intergenic
988119827 5:26946938-26946960 AACAGTGGTGAGATGGTGTCAGG + Intronic
988414210 5:30925536-30925558 CAAAATAGTGAGGTGGAGCCAGG + Intergenic
988838356 5:35056919-35056941 CAGAATTGTGAAATGGTGTGTGG - Exonic
988994737 5:36703932-36703954 GATACTGGTGAGATGGAGCCAGG - Intergenic
989236888 5:39158410-39158432 CAAAATGGTGAGATTTTGTCAGG + Intronic
989425371 5:41290430-41290452 CAACATGGTGAGGTGGAGTGGGG + Intergenic
990499022 5:56376535-56376557 CAGAATGGGGAGCTGGAGAGGGG + Intergenic
992015388 5:72569999-72570021 CTGAATGGTGAGTAGGAGCCAGG - Intergenic
992786330 5:80173793-80173815 CAGAAAGGTGAAAAGGTGTCAGG - Intronic
993482233 5:88438174-88438196 CAGAAAGGTGACCTGGAGTTTGG - Intergenic
996504072 5:124249547-124249569 CAGAGTGGTAAAATGGACTCTGG + Intergenic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
998642326 5:144025139-144025161 TAGAATGGTGAGATGAAATTAGG + Intergenic
999473232 5:151874762-151874784 CTGAAGGGTGAGAAGGAGCCAGG + Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
1000213243 5:159129827-159129849 CTGAAGGGTGAAATAGAGTCAGG + Intergenic
1000374704 5:160568502-160568524 CAGCGTGGTGAGATGGAGAGAGG + Intronic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1001726689 5:173908562-173908584 CTGCATGATGAGATGGGGTCAGG + Intronic
1002763620 6:220071-220093 CAGAATGGGGAACTGGAGCCGGG + Intergenic
1004801219 6:19150586-19150608 CAGAATGGGGTGATGGAATGTGG + Intergenic
1005824896 6:29626924-29626946 TAGAAGGATGAGAAGGAGTCAGG + Intronic
1006817662 6:36863809-36863831 CAGAAGGGTGACATCGAGTGTGG - Intronic
1007963449 6:45982228-45982250 CAAACTGATAAGATGGAGTCAGG - Intronic
1008216787 6:48800812-48800834 CAGAATGGTTGCATGGAGCCAGG + Intergenic
1011002686 6:82608513-82608535 CAGAGAGGACAGATGGAGTCAGG - Intergenic
1011907656 6:92392306-92392328 CAGAATGTAGGGATGGAGTGGGG - Intergenic
1013371552 6:109475114-109475136 CAGAATAGTGAGTCTGAGTCTGG - Intronic
1013611687 6:111801962-111801984 TTGAATGCTGAGATGGTGTCTGG - Intronic
1013810110 6:114035187-114035209 CATAATGGAGGGATGGAGTGAGG + Intergenic
1018626588 6:165784863-165784885 CAGAATGGTAAGGGGGAGTTGGG + Intronic
1019730796 7:2628330-2628352 CAGAAGGCTGAGATTGAGGCGGG + Intergenic
1020205743 7:6113914-6113936 CAGAAGGCTGAGATTGGGTCGGG - Intronic
1020484716 7:8706895-8706917 CAGAATGGTGAGAGTGAGAAGGG + Intronic
1021508898 7:21414155-21414177 CAGAAAGGTAAGAAGGAGTGAGG - Intergenic
1021996914 7:26187875-26187897 CAGCATGTTAAGATGGAGGCAGG - Intergenic
1022562528 7:31364567-31364589 AAGAATGGTGTGGTGGAGACAGG + Intergenic
1022720656 7:32939448-32939470 CAGAGTGGACTGATGGAGTCAGG + Intergenic
1023727902 7:43163444-43163466 AAGACTGGGGAGATGGAGGCAGG + Intronic
1024568524 7:50704925-50704947 CAGAGTGGTGGGAAGGAGTGTGG - Intronic
1026664305 7:72329333-72329355 CAGAATGGACAGCTGGAGACAGG + Intronic
1026794710 7:73359065-73359087 CAGGAGGGTGAGATGGCCTCAGG - Intergenic
1029123904 7:98284752-98284774 TAGAAAGGGAAGATGGAGTCAGG - Intronic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1030737357 7:113065371-113065393 CAGCATGGTGAGCAGGAGTTTGG + Intergenic
1032616496 7:133478007-133478029 CAGAATGCCCAGATGGAATCAGG + Intronic
1033601929 7:142894578-142894600 AAGAATCGTGTGATGGAGGCTGG - Intergenic
1035960040 8:4126552-4126574 CACAATTGTGGGATGGAGACTGG + Intronic
1036212736 8:6855300-6855322 CAGCATTGTGAGATGGAGCATGG - Intergenic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1039271951 8:35891843-35891865 CAGAATGGTTTGAAGGAGTTGGG + Intergenic
1039887538 8:41663770-41663792 AAGATTGGTGAGTGGGAGTCTGG + Intronic
1041119041 8:54568027-54568049 CAGAATGGAAAAATAGAGTCTGG - Intergenic
1041131592 8:54707745-54707767 CAGACTGGTGAGTTTGTGTCAGG + Intergenic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1045766736 8:105681276-105681298 CAGCATGGTAGGATGGATTCTGG - Intronic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1047005293 8:120613753-120613775 CAGAGTGGTGAGATTGATTTAGG + Intronic
1048203971 8:132400936-132400958 CAGAATGCTGAGATCATGTCAGG - Intronic
1048533954 8:135275282-135275304 CAGGATGGAGTGATGGAGTTGGG + Intergenic
1048618243 8:136103190-136103212 CAGAAAGGTGAGAGGGTGTGAGG - Intergenic
1049001318 8:139827151-139827173 CAGAATGGTGAGCTAGAGCCCGG + Intronic
1049398538 8:142413098-142413120 CTCAATGGAGAGATGGAGGCTGG - Intergenic
1049469284 8:142768266-142768288 CAGGATGGTGGGATGGGCTCTGG + Intronic
1049761758 8:144334814-144334836 CAGGATGGTGAGAGGGAGTTCGG - Intronic
1050615939 9:7401772-7401794 GAAAATGGGGAGAGGGAGTCTGG + Intergenic
1051855849 9:21564351-21564373 CTGAGTGGTGAGATGGAGTATGG + Intergenic
1053054786 9:34988012-34988034 GAGGATGGTGAGATGGGGTGAGG - Intergenic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1055300028 9:74873090-74873112 TAGAATGTAGAGATGGAGGCAGG - Intronic
1055438062 9:76312105-76312127 AAGAATGGAGAGAGGGAGGCAGG + Intronic
1059909470 9:119026304-119026326 AAGAATGGTGCGCTGGAGTGGGG + Intergenic
1061884875 9:133586395-133586417 CAGAGTGGGGAGCTGGTGTCTGG + Intergenic
1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG + Intronic
1188215481 X:27471443-27471465 AAGAAAGGTGAGATGGGGTGAGG - Intergenic
1188837517 X:34977526-34977548 CAGAATGGTGGCATGGAGAATGG + Intergenic
1189003788 X:36973853-36973875 CAGAATAGGGAGTTGGAGTGGGG + Intergenic
1189192673 X:39123925-39123947 CAGAATGGAGAGATGAAGAGAGG - Intergenic
1189255945 X:39639212-39639234 CACAATGGAGAAATGGAGACTGG + Intergenic
1189341592 X:40208682-40208704 AAGGATGGTGAGAGGAAGTCAGG + Intergenic
1189535325 X:41929047-41929069 CAGAAGGGTGGGAGGGGGTCAGG + Intergenic
1192176989 X:68892468-68892490 AATTATGGTGTGATGGAGTCAGG + Intergenic
1194970764 X:100341081-100341103 CAGAATGTTTAGATGGACTTGGG - Intronic
1195221796 X:102751513-102751535 CAGTGTGGTGAGATGGGTTCTGG - Exonic
1195693166 X:107645965-107645987 AAGCATGGAGAGATGGAGTGGGG - Intronic
1195869135 X:109467966-109467988 CAGAATTGAGATAAGGAGTCTGG - Intronic
1197623697 X:128780369-128780391 CAAAATGGTGAAAGGGAGACAGG + Intergenic
1198417194 X:136432631-136432653 CAGAATGGTATAATGGACTCTGG - Intergenic
1198670500 X:139075219-139075241 CAGAATGGGAAGATAGAGTCTGG - Intronic
1199083492 X:143604100-143604122 CAAAATGGTGAGGAGGAGCCTGG - Intergenic
1200213269 X:154356307-154356329 CAGAATGGAGACAGGGAGCCCGG - Intronic