ID: 1148645353

View in Genome Browser
Species Human (GRCh38)
Location 17:49217112-49217134
Sequence TGTGCGCTAGAACACTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148645353_1148645361 13 Left 1148645353 17:49217112-49217134 CCGCCACAGTGTTCTAGCGCACA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1148645353_1148645355 -1 Left 1148645353 17:49217112-49217134 CCGCCACAGTGTTCTAGCGCACA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148645353 Original CRISPR TGTGCGCTAGAACACTGTGG CGG (reversed) Intronic
908494938 1:64685423-64685445 TGTACCCTTGTACACTGTGGAGG + Intronic
915645711 1:157270475-157270497 TGTGCCCTAGGAAACTATGGAGG + Intergenic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
920212143 1:204335940-204335962 TGTGCCCTGGAACACTTTAGAGG - Intronic
1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG + Intronic
1065868328 10:29933677-29933699 CTAGCACTAGAACACTGTGGGGG + Intergenic
1070815063 10:79317678-79317700 TGTGCCTTAGAGCAGTGTGGTGG + Intergenic
1071085214 10:81862190-81862212 GGTTCCCTCGAACACTGTGGAGG - Intergenic
1079767084 11:24407190-24407212 TGTGCGGTCGGGCACTGTGGTGG - Intergenic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1092860498 12:12716130-12716152 TGTGGGCTTGAGCACCGTGGTGG - Intronic
1097614655 12:61869626-61869648 TGTGCTCTGTTACACTGTGGAGG - Intronic
1108266417 13:48713341-48713363 TGTGAGCTGAAACACTGTGCTGG - Intergenic
1108266977 13:48720658-48720680 TGTGAGCTAAAACACTGTTCTGG - Intergenic
1113563664 13:111304225-111304247 TCTGCACTGGAACACAGTGGGGG - Intronic
1113604079 13:111592419-111592441 TGTCCGCTAAAACTTTGTGGTGG - Intronic
1123410741 15:20056776-20056798 TCAGCTCTAGCACACTGTGGAGG - Intergenic
1123520070 15:21063482-21063504 TCAGCTCTAGCACACTGTGGAGG - Intergenic
1124786130 15:32682263-32682285 TGTGCACTAGAACCATGAGGAGG - Intronic
1125101822 15:35922556-35922578 TGTGCCTTAGGGCACTGTGGTGG - Intergenic
1130174948 15:81558971-81558993 TGTGTGCTCTAACCCTGTGGGGG + Intergenic
1140848911 16:78916101-78916123 TGTGCGGGAGTACACTGTGCTGG - Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149320322 17:55475051-55475073 TGTCCTCTTAAACACTGTGGGGG - Intergenic
1155073633 18:22337033-22337055 TGTGCTCAAGAACCCTGGGGTGG - Intergenic
1156945357 18:42822984-42823006 TGTGCCCAAGAAAACTATGGTGG + Intronic
1162440784 19:10690859-10690881 TGTGTGCTAGAAAACTTTTGAGG + Exonic
925218694 2:2120574-2120596 TGTACGCTGGTACACTGTGAGGG + Intronic
927736654 2:25529541-25529563 TGTGCTATGGAACACTGTGTAGG + Intronic
927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG + Exonic
929418145 2:41764780-41764802 TATGAACTATAACACTGTGGAGG + Intergenic
933166448 2:79082079-79082101 TGTGAGCCAGAAGACAGTGGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934133626 2:88972719-88972741 TCTGAGCTATAACACTGTGAGGG + Intergenic
935101840 2:100003371-100003393 TGTGCCCTAGAACATTCTAGAGG + Intronic
937077282 2:119116556-119116578 TGTGCCCTAGAACAGTCTTGTGG - Intergenic
944138772 2:196432034-196432056 TTGGGGCTAGATCACTGTGGAGG + Intronic
948084346 2:235234240-235234262 TGTGCACTAGGGCACTATGGTGG + Intergenic
1171341491 20:24432152-24432174 TTTGGGCTAGAAGGCTGTGGGGG - Intergenic
1175330096 20:58157820-58157842 TGTGGCCTAGAACACTGGGCTGG + Intronic
1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG + Intronic
950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG + Intergenic
956258326 3:67308501-67308523 TGTGCTTTAAAATACTGTGGTGG - Intergenic
960121343 3:113951050-113951072 TGTGCGCAACAAAGCTGTGGTGG - Intronic
962463754 3:135638244-135638266 TGGGAGGAAGAACACTGTGGAGG - Intergenic
970428337 4:15965389-15965411 TGTTCCCTGCAACACTGTGGTGG - Intronic
975110930 4:70625706-70625728 TCTGAGCTAGAACTCAGTGGTGG - Intergenic
983663375 4:170154808-170154830 TGTGGGCTAGCTCACAGTGGTGG + Intergenic
985908190 5:2858042-2858064 TGTGTGGCAGAACACTGAGGGGG + Intergenic
986899360 5:12412895-12412917 GGTGCTCTACAACTCTGTGGCGG + Intergenic
989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG + Intronic
990982321 5:61613211-61613233 TAAGTGCTAGAACACTGTGCTGG + Intergenic
993564555 5:89457347-89457369 TGTTGGCTAGAACACTGAGCTGG + Intergenic
996373453 5:122776745-122776767 TGTGAACTAGAATACTGTGAAGG + Intronic
999730501 5:154473658-154473680 TGGGCGCTAGGAAACAGTGGGGG - Intergenic
999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG + Exonic
1000649155 5:163794497-163794519 TGTATGCTATAATACTGTGGTGG + Intergenic
1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG + Intronic
1002334522 5:178468671-178468693 TGTGCCCCAGAACACAGTTGAGG - Intronic
1002523094 5:179802024-179802046 TGTGCGCTGGCACACTGGAGGGG - Exonic
1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG + Intronic
1007308863 6:40929102-40929124 TGTGCACTAGAAAAATCTGGTGG - Intergenic
1007329530 6:41094328-41094350 TGTGCACTAGATAACTGTGCTGG + Intronic
1008385704 6:50887483-50887505 TGAGAGCTAGATCACTCTGGAGG - Intergenic
1013194502 6:107833382-107833404 TCTCCGCTTGAACCCTGTGGAGG + Intergenic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1017631959 6:156404760-156404782 TGTATGGTAGAACACAGTGGAGG + Intergenic
1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG + Intergenic
1024574894 7:50755463-50755485 GGTGGGCTAGAACACAGTGTGGG - Intronic
1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG + Intronic
1030056947 7:105591525-105591547 TATGCTCTAGAACCCTGCGGGGG - Intronic
1032106337 7:129034391-129034413 TGTGGGCAGGAACACTGAGGTGG + Intronic
1035875950 8:3189867-3189889 TGCCCGCCAGAACTCTGTGGTGG - Intronic
1035997117 8:4560557-4560579 TGTGAGCTAAAACACTGTGCTGG + Intronic
1037706414 8:21319159-21319181 TGGGCTCTAGAACAGTGTGGGGG + Intergenic
1038892329 8:31739572-31739594 TGTGTGCTAAAACATTGTTGTGG + Intronic
1044277695 8:90321617-90321639 TGGGCGGGAGAACACTGTAGGGG + Intergenic
1045786481 8:105927150-105927172 TGAGCGCTAGAATCCTCTGGAGG - Intergenic
1045890313 8:107148230-107148252 TGTGCGCAGGAACACGGTGAGGG + Intergenic
1047083490 8:121491293-121491315 TGTGTGCTAGAGAACAGTGGCGG - Intergenic
1057784684 9:98077968-98077990 TTTGCTCAAGAACACTGTCGGGG + Intronic
1187480329 X:19649154-19649176 GGGGAGCAAGAACACTGTGGAGG - Intronic
1189988569 X:46574541-46574563 GGTGCGCCAGGACACAGTGGCGG - Exonic
1190653945 X:52594587-52594609 TGGGGGCTATCACACTGTGGTGG + Intergenic
1195331077 X:103801189-103801211 GGGGTGCTGGAACACTGTGGAGG - Intergenic
1196687636 X:118525788-118525810 TTTGTGCTAGAAAACTCTGGGGG + Intronic
1199606142 X:149581173-149581195 GGTGCGCTTGAACACAGTGCAGG - Intergenic
1199632979 X:149788195-149788217 GGTGCGCTTGAACACAGTGCAGG + Intergenic
1201271599 Y:12261095-12261117 TGTGAGCTGAAACACTGTGAGGG - Intergenic