ID: 1148645355

View in Genome Browser
Species Human (GRCh38)
Location 17:49217134-49217156
Sequence ACACCCTCCTCCTTCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 1, 2: 3, 3: 61, 4: 523}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148645348_1148645355 8 Left 1148645348 17:49217103-49217125 CCCTCCACCCCGCCACAGTGTTC 0: 1
1: 0
2: 0
3: 13
4: 267
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645347_1148645355 25 Left 1148645347 17:49217086-49217108 CCACTATACAGTATACACCCTCC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645346_1148645355 28 Left 1148645346 17:49217083-49217105 CCACCACTATACAGTATACACCC 0: 1
1: 0
2: 2
3: 4
4: 82
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645352_1148645355 0 Left 1148645352 17:49217111-49217133 CCCGCCACAGTGTTCTAGCGCAC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645351_1148645355 1 Left 1148645351 17:49217110-49217132 CCCCGCCACAGTGTTCTAGCGCA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645349_1148645355 7 Left 1148645349 17:49217104-49217126 CCTCCACCCCGCCACAGTGTTCT 0: 1
1: 0
2: 0
3: 23
4: 353
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645350_1148645355 4 Left 1148645350 17:49217107-49217129 CCACCCCGCCACAGTGTTCTAGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645353_1148645355 -1 Left 1148645353 17:49217112-49217134 CCGCCACAGTGTTCTAGCGCACA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523
1148645354_1148645355 -4 Left 1148645354 17:49217115-49217137 CCACAGTGTTCTAGCGCACACAC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG 0: 1
1: 1
2: 3
3: 61
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148645355 Original CRISPR ACACCCTCCTCCTTCCTTCC TGG Intronic
900121954 1:1052052-1052074 TCCCACTCCTCCATCCTTCCTGG + Intronic
900143702 1:1149244-1149266 ATTCCCTCCTCCTTCCCTCGGGG - Intergenic
900379545 1:2377115-2377137 TCACCCTCCTCCTCCCTGCTGGG + Intronic
900680058 1:3911713-3911735 GCTCCCTCCTTCCTCCTTCCAGG + Intergenic
900737947 1:4310901-4310923 TCAGCCTCCACATTCCTTCCAGG - Intergenic
900955265 1:5882848-5882870 ACACCCTCCTCTCGCCTGCCAGG + Intronic
902045676 1:13522357-13522379 GCACGCACCTCCCTCCTTCCAGG + Intergenic
902637603 1:17744820-17744842 ACACCCGCCTGCTCCCTGCCTGG - Intergenic
903318907 1:22529931-22529953 TCACCATTCTCCTTCCTTTCTGG - Exonic
903927230 1:26839219-26839241 AGGCCCTCCTGCTGCCTTCCAGG - Intronic
904670773 1:32163310-32163332 GCACCCTCCTCTTTCTTACCTGG - Exonic
904893697 1:33798494-33798516 ACACCCTTCTCCATCCCGCCAGG - Intronic
906845669 1:49189051-49189073 CTACCCTCCTCTTTCCTTCTGGG - Intronic
907220640 1:52904837-52904859 CCACCCTGCTCCCTCCATCCTGG - Intronic
907447476 1:54518052-54518074 ACCACCTCCTCCCTCCTTCCTGG - Intergenic
907497038 1:54852077-54852099 CCACCTTCCTCCTGGCTTCCAGG - Exonic
907723309 1:56994546-56994568 ACAACATCCTCCTTCCTGTCTGG + Intergenic
908113677 1:60921094-60921116 ACCCCCTCTCCCTTCCTGCCTGG - Intronic
908578933 1:65493030-65493052 TCTTCCTCCTCCTTCCATCCTGG + Intronic
909597425 1:77422227-77422249 ACACCCTCAGCCTTCCTCCCTGG + Intronic
911069939 1:93824636-93824658 AGACCCTCCTCCTTTCTTAGTGG + Intronic
911266924 1:95753760-95753782 ACACCCACCCCCTTCCAACCAGG - Intergenic
911529800 1:99031104-99031126 ACATCATCTTCCTTCCATCCAGG - Intergenic
912344202 1:108949197-108949219 ACACCCCCCTTCTCCATTCCAGG + Intronic
912735455 1:112146079-112146101 CCACCCTCCACCCTCATTCCAGG + Intergenic
912799220 1:112710851-112710873 ACTCCCTCCTCATTTCTTTCAGG - Exonic
913091011 1:115476659-115476681 AAACCCTCCTGCTTCCTGCTAGG + Intergenic
915511416 1:156388818-156388840 TCACCCTCCGCCTTCCTCCCGGG - Intergenic
915515012 1:156407653-156407675 GCAGCCTGGTCCTTCCTTCCAGG + Intronic
916714554 1:167438392-167438414 GCACCCTCTTCCTTCCTCCTTGG - Intronic
917137820 1:171804522-171804544 ACAATTTCCTTCTTCCTTCCTGG - Intronic
917284457 1:173409898-173409920 ACACCCTCCTGCTGCATTCAAGG + Intergenic
917449341 1:175134040-175134062 ACATCCTCCTCCTGTGTTCCTGG + Intronic
917963487 1:180164421-180164443 CCACCCACCTCCCTCCTTCGAGG + Intronic
918282908 1:183023391-183023413 ACCCCCTGCTCCTTCCTCCCCGG + Intergenic
919149811 1:193681563-193681585 ACACACACCCCCTTACTTCCTGG - Intergenic
919303101 1:195795236-195795258 AAACTCTTCTCCTTCTTTCCAGG - Intergenic
919755549 1:201064000-201064022 ACCCCCAGCTCCTGCCTTCCAGG - Intronic
920091545 1:203456559-203456581 ACGCCCTACTCCCTCCTTCTGGG - Intergenic
920185211 1:204155177-204155199 AAACTCTCCCCCTTCCTGCCAGG - Exonic
920229618 1:204461758-204461780 CCACACTCTTCCTTCCTCCCAGG - Intronic
920260704 1:204685855-204685877 CCACCCAACTCCTTCCTCCCGGG - Intergenic
922154759 1:223032144-223032166 ACATCCTGACCCTTCCTTCCAGG + Intergenic
922381419 1:225032219-225032241 TCTCCCTCCTTCTACCTTCCTGG + Intronic
922563725 1:226587600-226587622 AAACCCTCTTCATTCCTCCCAGG - Intronic
923518573 1:234718409-234718431 ACACCCTACTCCTTCATTAATGG - Intergenic
923777869 1:236996133-236996155 CCTCCCTCCTGCTTCCTTGCTGG - Intergenic
924931415 1:248736111-248736133 ACACCCTCCTTTTGTCTTCCTGG + Intronic
1063200416 10:3781719-3781741 GCACCCTCCTCCTGCCGTCGGGG + Exonic
1063613785 10:7585127-7585149 ACTCCCTCCCCCTTCCTTTCAGG - Intronic
1063676834 10:8147995-8148017 ACAACCTCCGCCTCCCTCCCAGG - Intergenic
1063702038 10:8394223-8394245 ACACCCCCACCCTGCCTTCCTGG - Intergenic
1064336613 10:14448782-14448804 TCCCTCTCCTCCTTCCTTGCCGG - Intronic
1064407309 10:15075618-15075640 ACACCCACCTCCCTCCTCCCTGG + Intergenic
1064462225 10:15546199-15546221 ACACCATTCTACTTTCTTCCCGG + Intronic
1067343919 10:45424679-45424701 ACGCCCTCCTTCTTCCATCCTGG + Intronic
1067433803 10:46263717-46263739 AGACACTGCTCCTTCCTTACAGG - Intergenic
1068514598 10:58010194-58010216 ACATAATCCTCTTTCCTTCCTGG - Intergenic
1069016255 10:63432480-63432502 GCTTCCTCCTCCTTCCTGCCTGG + Intronic
1069675315 10:70242433-70242455 ACTTTTTCCTCCTTCCTTCCAGG - Intergenic
1069868960 10:71521575-71521597 GCACCATCTTCCTTCCTGCCAGG + Intronic
1070312897 10:75286756-75286778 ACACCAACCTCCTGGCTTCCAGG + Intergenic
1070490433 10:76970774-76970796 GCAACCTCCTCCTTCATTCCGGG - Intronic
1070813794 10:79311274-79311296 CCACCCACCTCCTCCCTTCGGGG - Intronic
1071630243 10:87213896-87213918 ACTCCCTCCTCCTTGCCTGCAGG - Intergenic
1071674768 10:87645033-87645055 ACTCCCTCCTCCTGTCTCCCTGG - Intergenic
1071745491 10:88414321-88414343 ACAGCCTCATCCTTCCAACCTGG - Intronic
1072222106 10:93335280-93335302 ACACACTCCACCCTCCTGCCTGG - Intronic
1072653552 10:97314197-97314219 GCAACCTCCGCCTTCCTCCCAGG + Intergenic
1073037578 10:100574934-100574956 ACCCCCTCTTCCTTCCTGCCAGG + Intergenic
1073071025 10:100793341-100793363 TCACCCCTCTCCTTCCTCCCCGG + Intronic
1073480207 10:103781763-103781785 CCACCCTTCTCAGTCCTTCCGGG - Intronic
1074432227 10:113403936-113403958 ACATCCTGTTCCTTCCTACCTGG - Intergenic
1075055937 10:119218309-119218331 ACCCCCTCCCCTTCCCTTCCTGG - Intronic
1075601647 10:123773613-123773635 ACACACCGCTCCTTCCCTCCTGG + Intronic
1075613762 10:123875756-123875778 AAACCATCCTACTTCCATCCTGG + Intronic
1075781998 10:125023119-125023141 ACGCGCTCCTCCCTCCATCCTGG + Intronic
1077256919 11:1589433-1589455 ACACCATACTTCTTCCTTCCGGG + Intergenic
1077316924 11:1923485-1923507 TCATCCTCCTCCTCCCTTCACGG + Intronic
1077328344 11:1973240-1973262 AGAACCTTCTCTTTCCTTCCTGG - Intronic
1077391848 11:2303937-2303959 CCTCCCTCCTCCTTCCCTCAGGG + Intronic
1078394979 11:10973037-10973059 ACACCCCTCACCCTCCTTCCTGG - Intergenic
1079176202 11:18143641-18143663 ATACCCTCCTCCAGCCCTCCAGG + Intronic
1079388390 11:20000472-20000494 ACACCCTCCACACCCCTTCCTGG - Intronic
1080283769 11:30586009-30586031 CCGCCCTCCGCCTCCCTTCCCGG + Intronic
1080428386 11:32176501-32176523 ACATCCTCCTCCTGGCTGCCTGG - Intergenic
1081715534 11:45247292-45247314 ACTCCCTTCTCTTTCCTGCCAGG - Intronic
1082091205 11:48091085-48091107 ACACCCTCCGCCTTTCATCAAGG - Intronic
1083130728 11:60622227-60622249 ACCCCCTCCTCCTTCCTGGACGG - Intergenic
1083224052 11:61273578-61273600 TCACCCTCCCGCTTCCATCCAGG + Intronic
1083378709 11:62246520-62246542 ACATCCTCCTCATTCATGCCAGG + Intergenic
1084285127 11:68126083-68126105 ACACCCAGCTCTTTCCTTGCTGG - Intergenic
1084418115 11:69045628-69045650 ACACGTTCCTCCTTACTTTCCGG - Intergenic
1084582378 11:70032090-70032112 CCTGCCTCCTCCTTCCTCCCTGG - Intergenic
1084749831 11:71197282-71197304 ACACCCTCCTCCACCCCACCCGG - Intronic
1084802228 11:71552447-71552469 CCAAGCTCCTCCTTCCTTCTTGG + Intronic
1085044840 11:73346771-73346793 ACACCCTCTCCCTGCCCTCCTGG - Intronic
1085280403 11:75326186-75326208 GCACCCTCCTCCTCCCAGCCTGG - Intronic
1085290510 11:75395958-75395980 ATCCTTTCCTCCTTCCTTCCTGG - Intergenic
1085305189 11:75481783-75481805 GCACCCGCCTCCTCCCTTCCTGG - Intronic
1085751742 11:79168068-79168090 TCACCCTGCTCCTGCCTGCCAGG - Intronic
1086490936 11:87357179-87357201 ACTCCCTGCTCCTTCCTAGCTGG + Intergenic
1087534423 11:99425339-99425361 GGACCCTCCGCTTTCCTTCCAGG + Intronic
1088223104 11:107590717-107590739 CCACCCTTCACCTGCCTTCCCGG - Intergenic
1088723198 11:112612447-112612469 CCTCCCTCCTCCCTCCTTGCAGG - Intergenic
1089223328 11:116894100-116894122 ACTCCCTCCTCCCTCCTCCTGGG + Intronic
1089298570 11:117484089-117484111 CCTTTCTCCTCCTTCCTTCCGGG + Intronic
1089321051 11:117626917-117626939 CCACCCTCTCTCTTCCTTCCTGG - Intronic
1089870670 11:121670204-121670226 CCACCTTCCTTCTTCTTTCCGGG + Intergenic
1090405415 11:126473280-126473302 ACACCCACCCCCTCCCCTCCAGG + Intronic
1202811322 11_KI270721v1_random:28419-28441 AGAACCTTCTCTTTCCTTCCTGG - Intergenic
1091397834 12:164516-164538 GCACTCTCCTCTTGCCTTCCTGG + Intronic
1091636618 12:2201927-2201949 ACTCCCTCCTTCTCCCTTGCTGG - Intronic
1092008025 12:5085933-5085955 CCTGCATCCTCCTTCCTTCCTGG + Intergenic
1092510695 12:9153045-9153067 AAACTCTGTTCCTTCCTTCCTGG - Intronic
1093273708 12:17097728-17097750 ACACTCCCCTCCACCCTTCCAGG - Intergenic
1096148190 12:49293503-49293525 CCAGGCCCCTCCTTCCTTCCGGG - Intronic
1096193490 12:49634516-49634538 ACTCCCACCTGCTTCATTCCAGG + Exonic
1096395872 12:51266265-51266287 ACACCCTGCTCCATCCTGCCTGG + Intronic
1096459761 12:51815594-51815616 AGACCCTCCTCCTCTCTTGCTGG + Intergenic
1096467619 12:51856067-51856089 CCGCCCGCCTCCTTCATTCCCGG - Intergenic
1096541703 12:52311538-52311560 TCTCATTCCTCCTTCCTTCCAGG - Intergenic
1096732524 12:53625993-53626015 ACTCCCGCCTCCTTCCTTTGGGG - Intronic
1097650992 12:62297062-62297084 CCACTCCTCTCCTTCCTTCCTGG - Intronic
1097929834 12:65170612-65170634 ACACCCTCCTCCCTGCTCCGCGG - Exonic
1098444576 12:70552970-70552992 GCACCCTCTCCCTTCCTACCTGG - Exonic
1098471655 12:70852058-70852080 ACACTGTCTGCCTTCCTTCCAGG - Intronic
1100607688 12:96165328-96165350 CCACCTTCCTCCTTCCTGCAGGG - Intergenic
1101421666 12:104555937-104555959 AATCCCTCTCCCTTCCTTCCCGG - Intronic
1101523640 12:105507585-105507607 TCCCCCTCCTCCTTTCTTTCTGG + Intergenic
1101727090 12:107396793-107396815 GGACCTTCCTCCTTCCCTCCAGG + Intronic
1102187223 12:110958144-110958166 ACTCCCTCATCCATTCTTCCTGG + Intergenic
1102495844 12:113319227-113319249 ACTCCTTCCTCCTGCCTTCCAGG + Intronic
1102509404 12:113403962-113403984 ACCCCCCCCTCCCTCCTGCCAGG + Intronic
1103664922 12:122556090-122556112 ACAACCTCCACCTACCTCCCAGG + Intronic
1103698344 12:122835055-122835077 CCTCCCTCCTCCTTCCACCCAGG - Intronic
1104169754 12:126268727-126268749 ACTCCATCCTCCTTCTTTCCAGG + Intergenic
1104465822 12:128989547-128989569 ACATCTCTCTCCTTCCTTCCAGG + Intergenic
1104595027 12:130115100-130115122 AGACCCTCCTCCCTCATTCCTGG + Intergenic
1104883442 12:132088527-132088549 GCCTCCTCTTCCTTCCTTCCAGG + Intronic
1104883458 12:132088617-132088639 GCCTCCTCTTCCTTCCTTCCAGG + Intronic
1105284772 13:18994993-18995015 TCACCTTCTTGCTTCCTTCCTGG - Intergenic
1105761202 13:23515947-23515969 TCAACCTCCTCCTTCCTCACTGG - Intergenic
1106205989 13:27595140-27595162 ACAGCATCCTCTTTCCTGCCTGG + Intronic
1107074639 13:36309728-36309750 ACACTCCCCTCCTCCCTCCCCGG - Intronic
1107902099 13:45027142-45027164 CCTCCCTGCTCCTTCCATCCAGG + Intronic
1108077713 13:46698945-46698967 ACAACTCCCTCGTTCCTTCCCGG + Intronic
1108248876 13:48545043-48545065 ACAGCCCCATCCTTCCTTCCAGG - Intergenic
1108458529 13:50641838-50641860 AGAGCCTCCTCCTTCCTACCTGG - Intronic
1112399851 13:99067067-99067089 CAACCTTCCTTCTTCCTTCCAGG + Intronic
1113433785 13:110272980-110273002 TCCACCTTCTCCTTCCTTCCAGG + Intronic
1116271599 14:42776629-42776651 CCATCCTCCTTCTTCCTTCCTGG + Intergenic
1116353117 14:43891697-43891719 ATCCTCTCCTCCTTTCTTCCAGG - Intergenic
1117231703 14:53725568-53725590 CCACACTCCTCCATCCTCCCAGG + Intergenic
1117315776 14:54569001-54569023 CCAGCCTCCTCCTACCCTCCAGG - Intronic
1117748870 14:58900126-58900148 ACTCCCTCTTTCTCCCTTCCTGG + Intergenic
1118366584 14:65102056-65102078 ACCCCCACCTCCTCCCTTGCGGG - Intronic
1118885378 14:69861356-69861378 AGGCCCTCCTCTTTTCTTCCTGG + Intronic
1118887654 14:69879840-69879862 TCCCCCTCCTCCTTCCCTCAGGG - Intronic
1119053517 14:71394098-71394120 ACACCTTCCTCCGCCCTTGCTGG - Intronic
1119074394 14:71621406-71621428 ACACTGGCCTCCTTCCTACCTGG + Intronic
1119382397 14:74237640-74237662 ACATCCTCATCCATCCTCCCAGG + Intergenic
1120157103 14:81105546-81105568 GCATCCTCCTCCTCCCCTCCTGG + Intronic
1121041156 14:90749300-90749322 TCACCCTCCTCCTTCCTTAGGGG + Intronic
1121170268 14:91847983-91848005 AGACCCTCCTCCTTCAATTCAGG + Intronic
1121462103 14:94088470-94088492 AGACCCTCCTCCTCCAATCCTGG + Intronic
1121585267 14:95058902-95058924 ACACCCTCCTCCCTCTTGCCTGG - Intergenic
1122907871 14:104810518-104810540 ACACCCTCCTCCTCTCTGCGGGG + Intergenic
1123119029 14:105908523-105908545 CCTCCCTCCTCCTTCCTTCGGGG - Intergenic
1123121253 14:105918084-105918106 CCTCCCTCCTCCCTCCTTCAGGG - Intronic
1124078925 15:26473300-26473322 TCACGCTCCTCCTTCCTTGGAGG - Intergenic
1124104053 15:26721041-26721063 TCACCCTCCTCCATCCGCCCAGG + Intronic
1124829264 15:33132176-33132198 TCCCCCTCTTCCTTCTTTCCTGG + Intronic
1125409916 15:39395430-39395452 ACACCCTCCACCCTCTTCCCTGG - Intergenic
1125460740 15:39904521-39904543 GCACCCCCACCCTTCCTTCCTGG - Intronic
1127343003 15:58066220-58066242 ACCCCGTCCCCCTTCCTTTCCGG + Exonic
1127895614 15:63296218-63296240 AGACACTCCTCCATCCATCCTGG - Intronic
1128801916 15:70502413-70502435 ACACCCTCTTTCTTGCTTACCGG - Intergenic
1129055500 15:72817128-72817150 ACACAGTCCTCCATCCTTCTTGG + Intergenic
1129241204 15:74253240-74253262 ACAGCCTCCTCCTCCCTCCCTGG + Intronic
1129744512 15:78008530-78008552 TCCCCATCCTCCTCCCTTCCTGG + Intronic
1129891813 15:79076601-79076623 AGACCCTTCTGCTTCCTTCTTGG - Intronic
1131606287 15:93906423-93906445 ATTTCCTCTTCCTTCCTTCCTGG + Intergenic
1131900937 15:97086935-97086957 GCAGCCTCCTCCTACCTCCCGGG - Intergenic
1132042778 15:98538911-98538933 ACACCATCGTCCTCCCTTGCGGG + Intergenic
1133332315 16:4982241-4982263 ACCTCCTCCCCCTTCCCTCCTGG - Intronic
1134615934 16:15650872-15650894 CCACCCTGCTCCCTCCCTCCGGG + Intronic
1135728663 16:24876535-24876557 ACAAGCTCCTCCCTCCTCCCTGG - Intronic
1135913257 16:26580151-26580173 TCACTCTCCTCCCTCCCTCCAGG + Intergenic
1136995456 16:35185840-35185862 GCCCCCTCCTCCTTCCAGCCTGG - Intergenic
1137393155 16:48098020-48098042 ACACCCTCTTCCTTTTCTCCAGG - Intronic
1137609714 16:49810307-49810329 GCACCCACCTGCTCCCTTCCAGG + Intronic
1137803198 16:51279643-51279665 ACATTCTCCTGCTTCCTTCAAGG - Intergenic
1137947065 16:52743677-52743699 ACACCCTCTTTCTTCCTTAAAGG + Intergenic
1139255849 16:65541815-65541837 TCACCATCTGCCTTCCTTCCTGG + Intergenic
1139597621 16:67967633-67967655 TCTCCCTCCTCCTTCCTCCCAGG - Intronic
1139781191 16:69352800-69352822 ACACCCACCTCCTTCATGGCAGG + Intronic
1140050893 16:71480112-71480134 ACACCCTTCTCCCTCCCTGCTGG + Intronic
1140114013 16:72026193-72026215 ACACCCTCCTCATTCTCTCTGGG + Intronic
1140287216 16:73615196-73615218 CCTCCCTCCTCCTTTCTTCTAGG - Intergenic
1141551890 16:84811746-84811768 TCTCCTTCCTCCTTCCTACCTGG - Intergenic
1142136467 16:88453906-88453928 ACACCCTCCTCCCGGCCTCCGGG - Intronic
1142359809 16:89620697-89620719 AGACCCGCCTCCTGCCTCCCAGG - Exonic
1142985789 17:3694856-3694878 ACTCCCTCTCCCTTCCTCCCTGG - Intronic
1143101138 17:4505453-4505475 ACATCCTCCCATTTCCTTCCTGG - Intronic
1143388027 17:6543594-6543616 GCCCCCTACTCCTTCCTTCCTGG - Intronic
1143601431 17:7948627-7948649 AATCCTTCCTCCTTCCTCCCAGG - Exonic
1143993996 17:10991059-10991081 ACAAATTTCTCCTTCCTTCCAGG - Intergenic
1144726479 17:17504974-17504996 ACACCCTCCCCCTCTCCTCCTGG - Intergenic
1144760061 17:17702063-17702085 TCACACTTATCCTTCCTTCCAGG - Intronic
1144995442 17:19264989-19265011 GCCCCCTTCTCCTTCCCTCCAGG - Intronic
1145839856 17:27985202-27985224 TCACACTGATCCTTCCTTCCGGG - Intergenic
1146369452 17:32256242-32256264 CCACGCTTGTCCTTCCTTCCCGG - Intergenic
1146570321 17:33946872-33946894 ACATCCTCCTGCATCCTTCTGGG - Intronic
1146910502 17:36645554-36645576 ACTCTCTCCTCCCTCCTCCCTGG + Intergenic
1147426769 17:40349516-40349538 ACACCTGACTCCTCCCTTCCAGG - Intronic
1147845931 17:43403870-43403892 GCACCCAGCTCCTTCCTCCCAGG + Intergenic
1147955790 17:44133657-44133679 CCTCCCACCTCCTGCCTTCCTGG + Intergenic
1148077829 17:44949399-44949421 ACACCCTCCTCCTAGCCTCGTGG + Intergenic
1148326465 17:46786104-46786126 GCACCCTCCTCCCTTTTTCCAGG - Intronic
1148442155 17:47716975-47716997 CCACCCTCATCCCTCCTGCCTGG - Intergenic
1148546378 17:48522289-48522311 GCCCCCACCCCCTTCCTTCCCGG - Intergenic
1148645355 17:49217134-49217156 ACACCCTCCTCCTTCCTTCCTGG + Intronic
1148755600 17:49971549-49971571 ACCCCCTCCAAGTTCCTTCCCGG - Intronic
1148780314 17:50117723-50117745 GAACCCTCCTCCTCCCTTCCCGG + Intronic
1148871456 17:50660895-50660917 ACCCACTGCTCCTTCCTCCCTGG + Intronic
1148996264 17:51712884-51712906 TCACCCTCCTCCTGCCTTTATGG - Intronic
1149514176 17:57267486-57267508 ACTGCCTTCTCCTCCCTTCCCGG - Intronic
1151101541 17:71561694-71561716 ACACCCTTTTCCTCCCTGCCAGG - Intergenic
1151253163 17:72853647-72853669 ACACCCTCCTGTTTCCTACTAGG - Intronic
1151342203 17:73478892-73478914 ACACACACCTCCTTCCTCCATGG - Intronic
1152111482 17:78359731-78359753 CCGCGCTCCTCCTTCCTACCTGG + Exonic
1152179910 17:78812936-78812958 ACAGGCTCCTCCTCCCTTCCCGG - Exonic
1152412862 17:80138306-80138328 ACATACTCATCCTTCCTTCTAGG + Intronic
1152738977 17:82010921-82010943 TCTCCCGGCTCCTTCCTTCCAGG + Intronic
1154323837 18:13375757-13375779 GCACCCTCTTCCTCCCTGCCAGG + Intronic
1155213523 18:23622313-23622335 ACACTCCCCTCCTGCCTTCCAGG - Intronic
1156396537 18:36704635-36704657 ACACTCTGCTCCTTCCTGCCTGG + Intronic
1156479393 18:37426623-37426645 CCAGCCTCCTTCTTCCTTCCAGG + Intronic
1157220540 18:45825855-45825877 ACACCTGCTTCCTGCCTTCCAGG - Intronic
1157239814 18:45998543-45998565 ATAGCCTCCTCCCACCTTCCGGG + Intronic
1157305062 18:46511159-46511181 ACCCCCTCACCCTTCATTCCAGG + Intronic
1158137533 18:54224069-54224091 ACTTCCTCCTTCTTCCATCCGGG + Exonic
1158152369 18:54387373-54387395 TCTCACTCCTCCTTCCCTCCTGG - Intergenic
1158233955 18:55291703-55291725 CCACCCTCTTCCCTCCTGCCCGG + Intronic
1158688122 18:59633066-59633088 ACAGCCTCCTCCTCCTTCCCTGG + Intronic
1159130629 18:64276899-64276921 ACACTCCCCCACTTCCTTCCTGG - Intergenic
1159703663 18:71660603-71660625 ACACCCGACTCTTTCCTACCGGG - Intergenic
1160179118 18:76619123-76619145 ACTTCCTCCTCCTTCCCACCAGG - Intergenic
1160423815 18:78767084-78767106 CTGCCCTCCTCCTTCCTTCACGG - Intergenic
1160511218 18:79454551-79454573 CCACCCTCCTCCTGCCCTGCTGG - Intronic
1160864581 19:1251111-1251133 TCCCCCTCCTCCTCCCTCCCCGG - Intronic
1160955633 19:1690474-1690496 CCAACCTCCTCCTTCCTACCAGG - Intergenic
1160958840 19:1708238-1708260 TCACCTTCCTGCCTCCTTCCAGG + Intergenic
1161031157 19:2058300-2058322 ACAGACTCCTGCTTACTTCCTGG + Intergenic
1162094503 19:8302556-8302578 CCACCCTCCTCCTTTTGTCCTGG - Exonic
1162892723 19:13745569-13745591 GCAACCTCCACCTTCCTTCCGGG - Intronic
1163062216 19:14768887-14768909 TCTCCCTCCTCCTTCATTTCTGG + Intronic
1163209234 19:15828501-15828523 ACCCCCTCCCCCTACCTCCCGGG - Intergenic
1163271076 19:16254205-16254227 AAACCCTCCTCCCTCCTTTGAGG - Intergenic
1163491405 19:17619101-17619123 ACATCCTCCTCAGTTCTTCCTGG - Intronic
1163509288 19:17725732-17725754 ACACCCTCATCCTTTCCCCCAGG - Intronic
1163702685 19:18794072-18794094 ACAAACTCCTCCATCCTTCAAGG + Intergenic
1164825356 19:31281290-31281312 AGGCCCCCCTCATTCCTTCCAGG + Intronic
1165545879 19:36535480-36535502 ACACCCACCTCCTTTCCTCAGGG + Intronic
1166146981 19:40844772-40844794 ACAACTTCCTCCTCCCTACCAGG - Exonic
1166151139 19:40876668-40876690 ACAACTTCCTCCTCCCTACCAGG - Exonic
1166155642 19:40909372-40909394 ACACCTTCCTCCTCCCTCCCAGG - Intergenic
1166179167 19:41094937-41094959 ACACCTTCCTCCTCCCTCCCAGG + Exonic
1166683212 19:44780836-44780858 ACACCCTCTTCCTCCCCTCATGG - Intronic
1166691382 19:44823138-44823160 CTACCCTCCTCCGTCCTTCTAGG - Intergenic
1166749725 19:45159100-45159122 ACCCCCACTTCCTTCCTTCCAGG - Exonic
1167669410 19:50841229-50841251 CCACCCTCCTCCACCCATCCAGG - Intergenic
1168031431 19:53682991-53683013 CCAGCCTCCTGCTTCCCTCCAGG - Intergenic
1168038285 19:53737896-53737918 CCAGCCTCCTGCTTCCATCCAGG - Intergenic
1168041952 19:53765852-53765874 CCAGCCTCCTGCTTCCATCCAGG - Intergenic
1168278054 19:55287810-55287832 ACCCCCACCCCCATCCTTCCTGG - Intronic
925085206 2:1102334-1102356 CCACCTTCCTCCCTGCTTCCTGG - Intronic
925101814 2:1253404-1253426 GCACCATCGTCCTTCATTCCAGG + Intronic
925342284 2:3145908-3145930 TCCCCCACATCCTTCCTTCCTGG + Intergenic
925414098 2:3657357-3657379 ACACGCTCCTTTTTCCTTCCTGG - Intergenic
926442881 2:12908778-12908800 ACACCCCATTCCTACCTTCCAGG + Intergenic
926590908 2:14739319-14739341 ACGCTCTCCTGATTCCTTCCTGG - Intergenic
926602807 2:14864239-14864261 ACAACCTCCTCCTACCTCCTGGG - Intergenic
926781655 2:16478089-16478111 GCACCCGCCTCCTCCTTTCCCGG - Intergenic
929098807 2:38289641-38289663 ACAAGCTCCACCTTCCTCCCAGG + Intergenic
929335414 2:40737998-40738020 ACTTCCTCATTCTTCCTTCCTGG - Intergenic
929511697 2:42569464-42569486 ACGCCCTCCTCCCTCTTTCCTGG + Intronic
929551739 2:42897677-42897699 ACACCCTCCTCCATCCTGCTTGG + Intergenic
929654418 2:43716208-43716230 TCCCCCTCCTCCCTTCTTCCAGG - Intronic
929751730 2:44721901-44721923 ACTCCTCCCTCCTCCCTTCCAGG + Intronic
930554137 2:52873731-52873753 GTACCCAACTCCTTCCTTCCTGG + Intergenic
930912928 2:56651854-56651876 ACAATGTCCTCCTTCCTTCCTGG + Intergenic
932074724 2:68652023-68652045 GCCCCCTCCTCTTGCCTTCCTGG - Intronic
932544045 2:72688450-72688472 ACACCATCCTCCTTCCTGGTGGG + Intronic
932973233 2:76571339-76571361 ACTCCCTCCTCATATCTTCCTGG + Intergenic
933685972 2:85141477-85141499 GCAGCCTCCTCCTTCTATCCCGG + Intronic
933727894 2:85436815-85436837 ACACCCTCTTCCTGGCCTCCAGG + Exonic
933848094 2:86342088-86342110 ACACCCTTCCCCTTTCTTCTGGG + Intergenic
933892108 2:86781535-86781557 ACTTCCTCTTCCTTCCTGCCTGG - Intergenic
935553176 2:104479679-104479701 ACCCCTTCTTCCCTCCTTCCTGG - Intergenic
936469083 2:112781987-112782009 TCACCTTCCTTCCTCCTTCCAGG + Intronic
937168401 2:119843623-119843645 ACCCCCCCCACCTTCCCTCCCGG + Intronic
937341941 2:121096767-121096789 AGACCTACCTCCTTCCTTCCTGG - Intergenic
937860760 2:126707265-126707287 ACACCCTCCTGCTTGCCTCAAGG + Intergenic
938186865 2:129239874-129239896 GCAGCCTCTTCCTCCCTTCCCGG + Intergenic
938264603 2:129918102-129918124 CCACTCCTCTCCTTCCTTCCTGG - Intergenic
939124306 2:138157194-138157216 TCCCCCTCCTCCTTCCTGCCAGG + Intergenic
940918466 2:159283487-159283509 GCAACCTCCTCCTCCCTTCAAGG - Intronic
941731212 2:168920198-168920220 ACACATTCCTCCTTCTCTCCTGG + Intergenic
941910595 2:170760822-170760844 CCATCCTCCTCATTCCTTCTAGG - Intergenic
942946621 2:181680738-181680760 CGCCCCTCCTCCTTCCTCCCCGG + Exonic
944480669 2:200154334-200154356 ACTCCCTCCTCCTACTGTCCTGG - Intergenic
945975618 2:216268207-216268229 ACAACCTCCAGGTTCCTTCCAGG - Intronic
946449546 2:219768154-219768176 TGACCCTCCTTCATCCTTCCTGG - Intergenic
947521281 2:230848006-230848028 CCCTCCTCCGCCTTCCTTCCCGG - Intergenic
948386770 2:237585546-237585568 ACAGCATCTTCCTTCCTGCCTGG - Intronic
948489600 2:238304047-238304069 ACTCCCCCGTCCTTTCTTCCTGG + Intergenic
948588742 2:239036571-239036593 GCCCCCTCCTGCTTCCTGCCTGG + Intergenic
948641647 2:239379136-239379158 ACCCCCAGCTCCTGCCTTCCTGG - Intronic
948867273 2:240782435-240782457 ACACCCGCTTTCTTCCTTCCCGG + Intronic
948887021 2:240889580-240889602 ACACCCTTCTCTCTGCTTCCTGG - Intronic
948979113 2:241483748-241483770 CCAGCCTCCTTCTTCATTCCAGG + Intronic
1169090629 20:2859568-2859590 TCACCCTCCTCCCTCCCTCTGGG + Intronic
1169263381 20:4153437-4153459 ACACCCTCCTCCCTCCTTCCTGG - Intronic
1169503712 20:6185857-6185879 ACACTCTCTTCCCACCTTCCTGG + Intergenic
1169525500 20:6420890-6420912 ACACCCTCCTGGTTACTTCCAGG + Intergenic
1170099728 20:12685761-12685783 GCATCCTCATCCTTCCTGCCAGG + Intergenic
1170936292 20:20812737-20812759 ACACAAACCTCCTTCTTTCCTGG - Intergenic
1171143188 20:22760489-22760511 ACACTCTCCTCCTTCTGCCCTGG + Intergenic
1171216518 20:23356418-23356440 GCACCCTCCTCCTTCGGTTCTGG + Intergenic
1172020630 20:31911354-31911376 CCACCCTCCTGCTCCCTCCCTGG - Intronic
1172414901 20:34757435-34757457 TCACCCTCCTCCTTCCAGCAGGG - Exonic
1172617653 20:36299727-36299749 ACACCTTCCTCCTCTCTGCCAGG + Intergenic
1173784991 20:45786312-45786334 ACAACCTCCACCTACCTTCTGGG - Intronic
1174334964 20:49853459-49853481 ACATCATCCTCCTTCCTTCACGG + Intronic
1174473958 20:50782800-50782822 ACACCCTTTTCCTTATTTCCAGG + Intergenic
1174836848 20:53864059-53864081 ACACCGTGCTCCTGCCTTACTGG - Intergenic
1175555216 20:59848101-59848123 CTTCCCTCCTCCTTCCCTCCTGG + Intergenic
1175566835 20:59986513-59986535 AAACCCTCCCTCTTCTTTCCTGG + Intronic
1175644700 20:60661022-60661044 TCTGCCTCCTCCTTCCTTCTTGG + Intergenic
1175702414 20:61149451-61149473 ACACCCTCCTGCCTCTTCCCAGG + Intergenic
1175863293 20:62161544-62161566 CCACCCTCCTCCCTCCTGCAGGG + Exonic
1175940013 20:62533554-62533576 CCACCCTGCTCCTTCCTTGCTGG + Intergenic
1175954482 20:62602086-62602108 CCAACCTCCTCCTTGCTTTCTGG + Intergenic
1176670415 21:9728819-9728841 ACTCCTTCCTGCTTCATTCCAGG - Intergenic
1176980598 21:15376763-15376785 ACATCCTCCTCCTCCATCCCTGG + Intergenic
1178439978 21:32590940-32590962 TCAGCCTCCTCCTTCCTCTCTGG - Intronic
1179785579 21:43728043-43728065 ACACCCAGCTCCCTACTTCCAGG - Intronic
1180614449 22:17118796-17118818 CCACCCTCCTCTTTTCTGCCTGG - Exonic
1181330098 22:22084166-22084188 ACATCCTCATCCTTCCCTTCAGG + Intergenic
1182074147 22:27483498-27483520 ACTCCCTCCTCCTTTCCTGCAGG - Intergenic
1182258390 22:29054507-29054529 ACAACCTCCTCTTCCCTGCCCGG - Exonic
1182622187 22:31624214-31624236 ACACCCTGCTCTCCCCTTCCTGG - Intronic
1182735978 22:32532605-32532627 ACTCCCTCCTCCTACCTCCAAGG + Intronic
1183779318 22:39988693-39988715 ACTCCCCACTCCTCCCTTCCTGG - Intergenic
1184335040 22:43848034-43848056 CCACCCTCCTAATTCCTGCCTGG + Intronic
1184386599 22:44180077-44180099 TCACTCTCCTCCCTCCTGCCAGG - Intronic
949507163 3:4738887-4738909 ACACCCGCACCCTTCCATCCTGG - Intronic
949848520 3:8397454-8397476 ACAACCTGCTCCTTGCCTCCAGG - Intergenic
950152423 3:10698025-10698047 ACTCCCTCCTACTTCCTGGCTGG + Intronic
950424874 3:12919742-12919764 GTGCCTTCCTCCTTCCTTCCGGG + Intronic
950426413 3:12926963-12926985 AAACCCTGGTCCTTCCATCCTGG - Intronic
950488190 3:13285213-13285235 ACTCCCTGCTCCTTCCGGCCAGG + Intergenic
952370835 3:32721137-32721159 ACAGCCTCCACCTCCCTCCCGGG + Intronic
952810380 3:37397298-37397320 ACTCCCTCCTCTTGCCTTCTGGG + Intronic
953100517 3:39821161-39821183 ACATCCTTCTGCCTCCTTCCAGG - Intronic
953758867 3:45671247-45671269 ACGCCCTCCTCTTGCCTTCTTGG + Intronic
953881179 3:46692222-46692244 ACACTCTCCTCATCACTTCCAGG - Intronic
953884021 3:46705471-46705493 ACACCCTCCTACTCCAGTCCTGG - Intronic
953920984 3:46951268-46951290 ACACACTCCTCCTGCCTAACTGG - Intronic
954152188 3:48663092-48663114 TCACCCACCTCCCTCCTTCTAGG + Intergenic
954420447 3:50416316-50416338 TCACCCTCCTCCTTTCTTCCTGG - Intronic
954539500 3:51384464-51384486 CCAGCCTCCTCCTGCCTCCCCGG - Intergenic
954699165 3:52442581-52442603 ACACACTCCTCCCTCTGTCCTGG + Exonic
954715879 3:52526535-52526557 AGAAACTCCTCCTTCCTACCTGG - Intronic
955687481 3:61561791-61561813 AAACATGCCTCCTTCCTTCCCGG + Intronic
955807230 3:62749726-62749748 CCTCCCTCCTCTTTCCTTGCTGG - Intronic
955874195 3:63473151-63473173 ACACCCTTCTCCCTCTTACCTGG + Intronic
956197824 3:66670886-66670908 ACAACCTCCGCCTCCCTCCCAGG - Intergenic
957275542 3:78086293-78086315 CCATCCTGCTCCTTCCTGCCTGG + Intergenic
959573618 3:107910961-107910983 ACCCCCGCCCCCTTCCTCCCAGG + Intergenic
960806152 3:121585808-121585830 ACACCCGCTTCCTTCCTTTCTGG + Intronic
961080309 3:124021270-124021292 ACACACACCTGCTTCATTCCAGG - Intergenic
961629586 3:128286332-128286354 ACTCCCTCCTGCTTCCCGCCTGG - Intronic
961827917 3:129608211-129608233 ACACCCCTGCCCTTCCTTCCTGG - Intergenic
962454728 3:135554498-135554520 ACCCCCTTCTCCTTCTTTCCTGG + Intergenic
962684261 3:137831438-137831460 ACAGCTTCCTCTTTCCTTCTTGG - Intergenic
962964882 3:140344437-140344459 ACACTCTCCTCCTGCCTCCTGGG - Intronic
963044941 3:141095439-141095461 TCACCCACCTGCTCCCTTCCCGG + Intronic
963814341 3:149813006-149813028 CCACCCTGCTCTTCCCTTCCAGG + Exonic
964833289 3:160909965-160909987 ACAGCCCCTTCCTTCCTCCCAGG - Intronic
965083262 3:164063487-164063509 ACACCCTCCTCCTACTTCCAGGG - Intergenic
965325911 3:167303499-167303521 GCATCCTACTTCTTCCTTCCAGG + Intronic
965503706 3:169487213-169487235 GTATCCTACTCCTTCCTTCCGGG - Intronic
966374887 3:179286340-179286362 ACAAGTTCCTCCCTCCTTCCTGG - Intergenic
967324260 3:188223594-188223616 ACACTCTCCAGCTTCCCTCCAGG - Intronic
968653803 4:1770221-1770243 CAGCCCTCCTCCTTCCTGCCAGG - Intergenic
968755974 4:2416976-2416998 AAACCCACCTCCCGCCTTCCTGG + Intronic
968964756 4:3764250-3764272 ACACACACCTGCTTCCTTCATGG - Intergenic
969235745 4:5864204-5864226 ACACCCACCCCCGTCCTTCCTGG - Intronic
969334537 4:6499894-6499916 CCACTCTCCTTCCTCCTTCCAGG + Intronic
969334661 4:6500650-6500672 GAACCCCCCTCTTTCCTTCCTGG - Intronic
969345082 4:6564914-6564936 ACCCCCTCCCTCTTCCTTCTTGG + Intergenic
969374325 4:6753238-6753260 ACACCCGCCTCCTGCCTGCCTGG + Intergenic
969429836 4:7147684-7147706 AGAGCCTCCTCCTCCCTTGCTGG + Intergenic
969617997 4:8264963-8264985 ACTTCCTCCTCCATCCCTCCCGG - Intergenic
969780753 4:9401241-9401263 ACTCCCTCTTCCTCCCCTCCTGG + Intergenic
970570602 4:17377761-17377783 ACACAGTCCCCCTTCCTTTCAGG + Intergenic
971067609 4:23051465-23051487 AAACACTCTTCCTACCTTCCAGG + Intergenic
972020131 4:34302405-34302427 ACATCCTTCTCCTTTCTGCCTGG - Intergenic
972234675 4:37117276-37117298 ATATTCTCCTTCTTCCTTCCTGG - Intergenic
973647720 4:52966995-52967017 CCACACTCTTCCTTCCCTCCAGG + Intronic
974706969 4:65531352-65531374 ACCCTTTCCTCCTTCCTCCCTGG + Intronic
978306096 4:107330266-107330288 ATTCCCGCCTCCTTACTTCCTGG + Intergenic
978892467 4:113846809-113846831 GCAACATCCGCCTTCCTTCCGGG + Intergenic
979260150 4:118637199-118637221 ACACCCACCTCCTTCTTACTGGG - Intergenic
981906932 4:149932008-149932030 ACACTCTCCTCCCTGCTCCCTGG - Intergenic
982138209 4:152293015-152293037 TGACCCTCCTCCTCCCTTCCTGG + Intergenic
982615676 4:157636586-157636608 CCCCCCCCCACCTTCCTTCCCGG + Intergenic
983138985 4:164124774-164124796 CCACCCTCCACTATCCTTCCTGG - Intronic
983172342 4:164550100-164550122 ACATCCTGCTGCTGCCTTCCTGG + Intergenic
983701625 4:170603018-170603040 AGACCCTCATTCTTCCTTCAAGG + Intergenic
985404358 4:189622721-189622743 ACTCCCTCCTGCTTCATTCCAGG + Intergenic
986059221 5:4172378-4172400 ACCCCCGTCTCATTCCTTCCAGG - Intergenic
986380761 5:7183376-7183398 ACATTCTCCCCATTCCTTCCTGG + Intergenic
986473083 5:8094929-8094951 AGATCCTCCTCCTTCCTCTCTGG - Intergenic
986735170 5:10662849-10662871 TCACCCTCCTCTTTCCTTTATGG + Intergenic
986796452 5:11217359-11217381 AAAGCCACCTCCTTCCTCCCTGG - Intronic
988469859 5:31527688-31527710 ATGCCCTCCTCCTGCCTTGCAGG - Intronic
990060438 5:51640186-51640208 ACCAGCTCCTCCTTTCTTCCTGG - Intergenic
990184014 5:53193214-53193236 ACTCACTCCACCTTCCTTCCTGG + Intergenic
990448724 5:55916521-55916543 ACAGCCCCCACCTTCCTCCCAGG - Intronic
990519589 5:56565954-56565976 GCACCCTCCTCTTTTCTTCAAGG + Intronic
990633808 5:57700156-57700178 ACAACCTCATCCTTCTATCCAGG - Intergenic
991197745 5:63956087-63956109 ACACCCTGATCCCTTCTTCCTGG - Intergenic
991952997 5:71965071-71965093 ACACCTTCTTCCTTCTTCCCAGG - Intergenic
992515937 5:77492281-77492303 TCGGCCTCCTCCTTCCTCCCCGG + Exonic
992860024 5:80900129-80900151 ATACCACCCTCCATCCTTCCTGG - Intergenic
995448067 5:112268466-112268488 ACACCCTCCTCCTTCTCTATTGG + Intronic
996449837 5:123608458-123608480 GCACCTTCATCATTCCTTCCAGG + Intronic
996553197 5:124751197-124751219 ACCCCCACCTCCTTCCTCCCAGG + Intergenic
999129608 5:149272469-149272491 ACCCCCGCCTCCTCCCTCCCTGG - Intronic
999774680 5:154802917-154802939 TCTCCTTCCTCCTTACTTCCAGG - Intronic
999810952 5:155126736-155126758 ACACCCACATTCATCCTTCCAGG - Intergenic
1001533973 5:172485581-172485603 ACACCCTGCTCCATGCTTCTGGG - Intergenic
1001652146 5:173323671-173323693 ACATCTCCCTCCTTCCTCCCTGG + Intronic
1002185755 5:177454192-177454214 ACACTCTCTTCCTTTCCTCCAGG - Intronic
1002451284 5:179320218-179320240 GCTCCCTCCTCCAGCCTTCCAGG + Intronic
1002814813 6:669663-669685 CCATCCTTCTCCATCCTTCCAGG - Intronic
1003941332 6:11030252-11030274 AGACCCTAATCCTTCCTTCTTGG - Intronic
1004001748 6:11602705-11602727 ACATCTTCCTCCTCCCTCCCAGG + Intergenic
1004135046 6:12957847-12957869 AGCCCCTTCGCCTTCCTTCCCGG - Intronic
1004785108 6:18959954-18959976 ACACCCTCCTCTGTCCTGCAGGG + Intergenic
1005640415 6:27791266-27791288 ACACCTTTCTCATTCCATCCTGG - Intergenic
1005659628 6:27983183-27983205 ACATCCTCCTTTTTCCTTTCTGG + Intergenic
1005861596 6:29906712-29906734 ACATCCTCATCCTTCCCTCTGGG + Intergenic
1006442468 6:34060923-34060945 AAGCCCTCCTCCATCCCTCCAGG + Intronic
1006798563 6:36745545-36745567 GCACCCCTGTCCTTCCTTCCTGG - Intronic
1007101597 6:39251401-39251423 ACAACTTCTTCCTGCCTTCCTGG - Intergenic
1007191290 6:40021118-40021140 GCCTCCTCCTGCTTCCTTCCTGG - Intergenic
1007317356 6:41000096-41000118 ACATCTTCCTCCTGCCTTCATGG - Intergenic
1007371520 6:41429260-41429282 ACTCCCTCCTCCTCCTTTCCAGG - Intergenic
1007450916 6:41940132-41940154 ACCCCCTCCTCCTGACCTCCAGG - Intronic
1007509121 6:42362021-42362043 AGTCCCTCCCTCTTCCTTCCAGG + Intronic
1007652038 6:43428752-43428774 ACACCGTCCTCCTATCTTCTCGG - Intronic
1007665796 6:43512315-43512337 TCACCTTCCATCTTCCTTCCAGG - Exonic
1007690783 6:43699811-43699833 CCACCCCGTTCCTTCCTTCCAGG - Intergenic
1008715369 6:54282904-54282926 ACAGCCTCCTCTCTCCCTCCAGG - Intergenic
1010042106 6:71396956-71396978 ACACCTTCCTCCTTGCTTTTGGG - Intergenic
1010061691 6:71629824-71629846 ACTCCTTCCTCCTCCCTACCTGG + Intergenic
1010456351 6:76060523-76060545 GCACCCTCCTCCTTTATTACAGG + Intronic
1011349313 6:86404950-86404972 GCACTTTCCTCCTTCCTTCATGG + Intergenic
1012488741 6:99753219-99753241 ACTCCCTCCTCATTGCTACCTGG - Intergenic
1013861032 6:114635663-114635685 ACTTCCTGCTCCATCCTTCCTGG + Intergenic
1014798333 6:125749686-125749708 ACGCCCGCCTCCTCCCTCCCCGG - Exonic
1016014337 6:139168237-139168259 TCCCCCTCCTCCTTCCTCTCAGG + Intronic
1016460793 6:144278640-144278662 CCACCCCCCTCCCTGCTTCCGGG - Intergenic
1017067584 6:150543525-150543547 TGACCCTCCCCCTTCCCTCCTGG + Intergenic
1017228412 6:152046054-152046076 ACTCCCTCTGCCTTCCTTCAAGG - Intronic
1017628955 6:156377315-156377337 ACATCCTCCACCATCCTTCTTGG - Intergenic
1018733398 6:166669793-166669815 ACCCCCTCCTCATTCCTCACTGG + Intronic
1018823884 6:167394942-167394964 TCAGCCTCCTCCTTCCTCTCTGG - Intergenic
1019323108 7:424570-424592 TCTCCCTCCTACCTCCTTCCTGG + Intergenic
1019639095 7:2093612-2093634 CTCTCCTCCTCCTTCCTTCCAGG + Intronic
1020225107 7:6273333-6273355 AGCCTCTCCTCCTTCCCTCCTGG + Intergenic
1020238632 7:6375024-6375046 CCACCCTCCGGCTTTCTTCCCGG + Intronic
1022036509 7:26539733-26539755 ACTACTTCCTCCTTCCTGCCTGG - Intergenic
1022951842 7:35346749-35346771 ACACCATCCCACTTACTTCCTGG + Intergenic
1023912090 7:44563477-44563499 ACACCTCCTTCCTCCCTTCCAGG + Intergenic
1023976993 7:45037843-45037865 ACACCTTCCACCTGCCTTCCTGG + Intronic
1024004640 7:45216528-45216550 TCAGCTTCCTTCTTCCTTCCAGG - Intergenic
1024051522 7:45626811-45626833 GCCCCGTCCTCCTTCCTGCCTGG - Intronic
1024057771 7:45675959-45675981 ACACCCTTTTTCTTCCTTTCGGG + Intronic
1024153820 7:46600079-46600101 ACTCCTCCCTACTTCCTTCCTGG - Intergenic
1024313482 7:47991748-47991770 ACACCCTCCTCCGGCCTTCCTGG - Intronic
1024363495 7:48494147-48494169 CCACCCTTCTCCTTCCTCCCTGG - Intronic
1024825806 7:53388018-53388040 TCACCCTTCTCCTTTATTCCAGG + Intergenic
1026895167 7:74006218-74006240 AGACCTTCCTTCGTCCTTCCAGG + Intergenic
1027029161 7:74875357-74875379 CCGCCCTCCACCTTCCTTCTGGG + Intergenic
1027145085 7:75688585-75688607 ACACCCTCCACCCGCCGTCCGGG + Intronic
1027463953 7:78491233-78491255 ACTCCATCCTCCCTCTTTCCTGG - Intronic
1029116164 7:98238323-98238345 ACACCCTCCTCCCACCCCCCCGG - Intronic
1029297530 7:99553226-99553248 ACATCCTCATATTTCCTTCCAGG + Intronic
1029524293 7:101085692-101085714 GCCCTCTCCTCCTGCCTTCCGGG - Intronic
1030212888 7:107013771-107013793 GCACTCTCTTTCTTCCTTCCCGG - Intergenic
1032334153 7:131009077-131009099 TCACCCTTCTGCTTCCTCCCAGG - Intergenic
1032389831 7:131548776-131548798 GCCCCCTCCTGCTTCCTACCAGG + Intronic
1032844484 7:135740832-135740854 TCATCCACCTCCTTTCTTCCTGG - Intronic
1033043139 7:137936904-137936926 ACACCCTCTTTCTGCCTCCCGGG + Intronic
1033113954 7:138608732-138608754 ACACACACCTCTTTTCTTCCAGG - Intronic
1033127465 7:138718400-138718422 GCACGCCCCCCCTTCCTTCCTGG - Intronic
1033127497 7:138718514-138718536 CCACCCGCCCCATTCCTTCCTGG - Intronic
1034673816 7:152877180-152877202 ACTCCCTCCACCTGCCCTCCTGG + Intergenic
1035057156 7:156043336-156043358 ACACCCTCCTTCCTCCTTACTGG - Intergenic
1036575431 8:10023470-10023492 TAACACCCCTCCTTCCTTCCTGG + Intergenic
1036681092 8:10874871-10874893 ACCCCATCTTCCTTCCATCCAGG - Intergenic
1037714327 8:21384099-21384121 ACACCAAACTCCTTACTTCCAGG + Intergenic
1038034270 8:23674024-23674046 ACCCCCAACTCCTCCCTTCCTGG + Intergenic
1039423618 8:37466816-37466838 AGACCTTCCTCCTTCCTGCTGGG - Intergenic
1039437908 8:37573368-37573390 ACTCCCTTCTCCTGACTTCCAGG + Intergenic
1039451020 8:37675238-37675260 CCTCCATCCTCCCTCCTTCCTGG + Intergenic
1039751267 8:40481135-40481157 ACACCCTCCACCATTGTTCCAGG + Intergenic
1040055667 8:43055459-43055481 ACCCCCACCTCCTTCCATCATGG + Intronic
1041085422 8:54252084-54252106 GGCACCTCCTCCTTCCTTCCAGG + Intergenic
1041864980 8:62561985-62562007 ACACCCTCATTCTTGCTTCCAGG - Intronic
1042484625 8:69336728-69336750 ACCCTCTCCTGCCTCCTTCCAGG - Intergenic
1042878626 8:73462995-73463017 AGCCCCTTCTTCTTCCTTCCAGG + Intronic
1044840046 8:96329587-96329609 ACACCCTCCTCATTCCACTCAGG + Intronic
1045332351 8:101166371-101166393 GTTCCCTCCCCCTTCCTTCCGGG + Intergenic
1045662990 8:104457329-104457351 ACATCCTGCTCCATCCTGCCTGG - Intronic
1046506700 8:115146373-115146395 ACAGCCTCCTTCCTCCTTTCTGG + Intergenic
1047343773 8:124007517-124007539 ACACCCACCCACTTCCTTCTTGG + Intronic
1047816818 8:128473767-128473789 ACACCCTCCTCAACCCTCCCAGG + Intergenic
1048008539 8:130438552-130438574 ACACCCTGCCCATCCCTTCCTGG + Intronic
1048063254 8:130942458-130942480 AAACACACCTCCTCCCTTCCTGG - Intronic
1048158018 8:131980809-131980831 ATACCCTCCTCCTCGCTTTCAGG + Intronic
1048978035 8:139683973-139683995 GCCCCCTCCTTCTTCCTGCCTGG + Intronic
1049152499 8:141044326-141044348 ACCCTTTCCTCCTTCCCTCCTGG - Intergenic
1049157427 8:141075521-141075543 CCACCCTCCTTCCTCCTTCTTGG + Intergenic
1049435776 8:142585625-142585647 CCTCCCACCTCCTTTCTTCCTGG + Intergenic
1049436670 8:142589293-142589315 CCACCCTCCCCTTTCCCTCCTGG - Intergenic
1049472360 8:142782216-142782238 ACTCCCTCTTCCTTCATTCCTGG + Intergenic
1049476943 8:142801273-142801295 ACCTCCTCCGCCTTCCCTCCAGG + Intergenic
1053071152 9:35102822-35102844 TCACCCTCTTCTTTCCTTCAGGG - Exonic
1053322107 9:37107872-37107894 ACAGCCACTCCCTTCCTTCCTGG - Intergenic
1056805913 9:89728825-89728847 GCACCCTCCTACAGCCTTCCCGG - Intergenic
1057127029 9:92625017-92625039 AGACCTTTCTCCTTCCTCCCAGG - Intronic
1058483158 9:105417392-105417414 TCACCCTCCTCCCTCCTGCTTGG + Intronic
1058628613 9:106962016-106962038 ACACTCTCCTTCATCTTTCCAGG - Intronic
1059408310 9:114116188-114116210 ACACCCTCCTCCCTCCTCCCTGG - Intergenic
1059740137 9:117142021-117142043 ACATGCTTCTCCTTCCATCCAGG - Intronic
1060108564 9:120890528-120890550 ACTCGCTCCTAATTCCTTCCTGG + Intronic
1060194723 9:121616253-121616275 ACAGCCTTCTCCTGCCTTTCTGG + Intronic
1060312489 9:122475124-122475146 ACACCCTCCTCCATCCAGCTTGG + Intergenic
1060742250 9:126107031-126107053 ACCCCCTCCTCCTAGCATCCTGG + Intergenic
1060955049 9:127632801-127632823 CTACTCCCCTCCTTCCTTCCTGG - Intronic
1060962851 9:127693414-127693436 ACACACACCGCCTTCCATCCTGG - Intronic
1061710067 9:132481264-132481286 TCACCCTCCTCCTTCCTGGATGG + Intronic
1061870303 9:133516834-133516856 CCTCCCTCCTTCTTCCTCCCGGG + Intronic
1061980049 9:134097317-134097339 GCAACCTCCACCTCCCTTCCTGG + Intergenic
1062028544 9:134351594-134351616 GCACCCTCCTCCACCCTCCCGGG - Intronic
1062069055 9:134545629-134545651 ACTCCCTCCACCGTCCATCCTGG + Intergenic
1062191377 9:135249572-135249594 TCTCCCTCGGCCTTCCTTCCTGG - Intergenic
1062192572 9:135255461-135255483 ACACCCACCTCTTTGTTTCCAGG - Intergenic
1062621861 9:137426439-137426461 ACCCCCTCCTCCATGGTTCCTGG + Intronic
1203361630 Un_KI270442v1:221967-221989 CCACCCGCCTCCTTTCTCCCAGG + Intergenic
1185573450 X:1152267-1152289 GCTCCCTCCTTCGTCCTTCCAGG - Intergenic
1185603760 X:1355449-1355471 TCCCCCTCCTCCTACCCTCCTGG - Intronic
1185666222 X:1767385-1767407 TCACCCTCCTCCTTACCTCCTGG - Intergenic
1186211188 X:7252371-7252393 ACACCTACCTGCTACCTTCCGGG + Intronic
1186660598 X:11664851-11664873 ACCACCTCCTCCTCCCTCCCTGG + Exonic
1187555818 X:20350124-20350146 ACTCCCTCATCCCTACTTCCTGG - Intergenic
1187562238 X:20413709-20413731 TCAGTCTCCTCCATCCTTCCAGG + Intergenic
1190114278 X:47615997-47616019 TCACCACCCTCATTCCTTCCTGG - Intronic
1190214039 X:48468450-48468472 TCACCCCCCTCCTTCCCGCCTGG + Intronic
1190298714 X:49043474-49043496 TCCCCCTCCTCCCTCCTCCCAGG + Exonic
1193312175 X:80022671-80022693 ACATCCTCCTCCTACCTTCGCGG + Intronic
1196108151 X:111918047-111918069 ACAGCCTCTTCCCTCCTCCCCGG - Intronic
1196504287 X:116422944-116422966 ACACCACCCTCTTTCCTCCCTGG + Intergenic
1196674301 X:118403093-118403115 CCACCCTGCTCCATCCTACCTGG - Intronic
1197949744 X:131881402-131881424 ACACCCTACTCCTCCCATTCAGG + Intergenic
1198171410 X:134108883-134108905 ACACTCTCCACTTTCCTTCCAGG - Intergenic
1198674268 X:139115456-139115478 CCATCCTCCTCCTTCCTGACTGG + Intronic
1199430729 X:147756977-147756999 ACCTCCGCCTCCTGCCTTCCGGG + Intergenic
1199864109 X:151827629-151827651 GTCGCCTCCTCCTTCCTTCCAGG + Intergenic
1199967925 X:152835078-152835100 CCAACCTCCTCCTTCCTGCTGGG - Intronic
1199992342 X:152994219-152994241 AAACCCTCCTACTTCCTGCAAGG + Intergenic
1201076810 Y:10195590-10195612 CCACCCGCCTCCTTTCTCCCAGG - Intergenic