ID: 1148645361

View in Genome Browser
Species Human (GRCh38)
Location 17:49217148-49217170
Sequence CCTTCCTGGATCCTTGACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148645354_1148645361 10 Left 1148645354 17:49217115-49217137 CCACAGTGTTCTAGCGCACACAC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1148645348_1148645361 22 Left 1148645348 17:49217103-49217125 CCCTCCACCCCGCCACAGTGTTC 0: 1
1: 0
2: 0
3: 13
4: 267
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1148645350_1148645361 18 Left 1148645350 17:49217107-49217129 CCACCCCGCCACAGTGTTCTAGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1148645353_1148645361 13 Left 1148645353 17:49217112-49217134 CCGCCACAGTGTTCTAGCGCACA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1148645349_1148645361 21 Left 1148645349 17:49217104-49217126 CCTCCACCCCGCCACAGTGTTCT 0: 1
1: 0
2: 0
3: 23
4: 353
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1148645351_1148645361 15 Left 1148645351 17:49217110-49217132 CCCCGCCACAGTGTTCTAGCGCA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1148645352_1148645361 14 Left 1148645352 17:49217111-49217133 CCCGCCACAGTGTTCTAGCGCAC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG 0: 1
1: 0
2: 1
3: 7
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148645361 Original CRISPR CCTTCCTGGATCCTTGACCG AGG Intronic
900429155 1:2593751-2593773 CCTTCCTGGCTGCTTCTCCGCGG + Intronic
900505426 1:3027926-3027948 GATTCCTGGAACCTTGACCTGGG - Intergenic
900761378 1:4473713-4473735 CCCTCCTGGATTCGTGACCACGG + Intergenic
900989457 1:6091615-6091637 CCCACCTGGAGCCTTGACCCTGG + Intronic
903358504 1:22762581-22762603 CCTTCCTGGCTTCATGACCTGGG + Intronic
904686633 1:32265651-32265673 CTTTCCTGGATCCTAGCCCAAGG + Intronic
907293423 1:53433382-53433404 CCTGCCTTGATCCTTCACCTTGG + Intergenic
907440758 1:54476691-54476713 TCTTCCTGCAGCCTTGACCCAGG - Intergenic
908654607 1:66374769-66374791 CCTTCCTGCATCATTGAGCTGGG - Intergenic
911774324 1:101788307-101788329 CCTTGCTGGCACCTTGACCTTGG + Intergenic
911966713 1:104380959-104380981 CCTGCCTTGATCCTTCACCTTGG + Intergenic
912762370 1:112380496-112380518 CTTTCCTGGAGCCTTGTCTGGGG - Intergenic
913049119 1:115100288-115100310 CCTTCCTGAGTGCTTGACCTGGG - Intergenic
915410245 1:155695523-155695545 TCTTCCAGGACCCTTGACTGAGG - Intronic
916713567 1:167432313-167432335 CCTTCCTGGCCCCTGGACCAGGG - Intronic
916751006 1:167722453-167722475 CTTTCCTGGATCCTGGAGTGCGG + Intronic
917877744 1:179301785-179301807 CCTTCATGGTTCCCTGAACGGGG + Intronic
924155804 1:241175418-241175440 CATTCATGGAGCCTTGACCAAGG - Intronic
1065788383 10:29237375-29237397 ACTTCCTGGGTCCTTGTCCCAGG + Intergenic
1069777444 10:70935220-70935242 GCTTCCTGGCTCCTGGACTGAGG - Intergenic
1070162702 10:73875154-73875176 CCTACCTGTATCCTTGCCCCTGG - Intergenic
1073459938 10:103660604-103660626 CCTGCCTGGACCCTGGACCCTGG + Intronic
1073496828 10:103899216-103899238 CTTTCCTGGTTCCTTGGCCCTGG - Intronic
1075670065 10:124258302-124258324 CCATCCTGGTTCCTGGACCCGGG - Intergenic
1081602496 11:44505053-44505075 CCCTCCTGGCCCCTTGACCGTGG - Intergenic
1081993120 11:47348063-47348085 CCTGCCTGGTACCTTGACCCTGG - Intronic
1083196831 11:61093286-61093308 CCTTCCTGGTCCCTTGACTCTGG - Intergenic
1083655216 11:64226189-64226211 ACCTCCAGGATCCTCGACCGCGG + Exonic
1084891061 11:72237444-72237466 CCAGCCTGGATCCTTTACCAGGG + Exonic
1084993923 11:72956604-72956626 ACTTCCTGGATCATGGACAGTGG + Intronic
1091121984 11:133064624-133064646 CATTCCCGGATCCTTCACCGAGG - Intronic
1097658904 12:62405527-62405549 GCATCCTGGATCCTTGAATGTGG - Exonic
1101556050 12:105810702-105810724 CCTTCCTGGATCATTTACCAGGG + Intergenic
1101659795 12:106755446-106755468 CCTTACTGGATGCATGACCTGGG - Intronic
1103163060 12:118746368-118746390 CCTTCCTGGCTACGTGACCTTGG - Intergenic
1103575789 12:121876340-121876362 ACTTCCTGGAGAATTGACCGTGG + Intergenic
1106499182 13:30310673-30310695 CCTTGGTGGGTCCTTGACCTTGG + Intergenic
1109525312 13:63567028-63567050 CCTTCCAGGAGCCTAGACCTAGG + Intergenic
1110439057 13:75507515-75507537 CCTTCCGGGATCCCAGACCTAGG - Intergenic
1112694957 13:101937525-101937547 CCTTACTGACACCTTGACCGTGG + Intronic
1113388467 13:109873118-109873140 CCACCCTGGAACCTTGACCTAGG + Intergenic
1117227215 14:53674498-53674520 CCTTGCTGGAACCTTGATCTTGG + Intergenic
1119114705 14:72008634-72008656 CTTTCCTGGATCCCTCACGGTGG + Intronic
1119248584 14:73133255-73133277 CCTGCCTTGATCCTTCACCTTGG - Intergenic
1121302356 14:92881614-92881636 CTTCCCTGGAGCCTTGACAGAGG - Intergenic
1123480477 15:20626937-20626959 CCTTCCTGTATCCTGGTCCCTGG + Intergenic
1123637531 15:22373430-22373452 CCTTCCTGTATCCTGGTCCCTGG - Intergenic
1124212443 15:27774870-27774892 CCCTCCTGGCACCTTGACCTTGG + Intronic
1124377791 15:29139739-29139761 CCTTCCTGGACCCTTTTCCCAGG + Intronic
1125628963 15:41132217-41132239 CCTGCCTTGATCCTTCACCTTGG + Intergenic
1126053035 15:44704978-44705000 CCTTTCTGTATTCTTGACCTTGG + Intronic
1126566771 15:50108996-50109018 CCTCCCTGGATCCCAGACCCCGG + Intronic
1131623263 15:94089766-94089788 CCTTGCTGGGTCATTGACCAGGG + Intergenic
1132812778 16:1809567-1809589 CTTTCCTGGCACCTTGGCCGGGG - Intronic
1132887768 16:2189986-2190008 CCTGCATGGATCCTTGGCTGAGG - Intronic
1133007935 16:2894981-2895003 CCTGCCTGGGTCCTGGACAGGGG + Intronic
1134835182 16:17355273-17355295 CCTTCCTGTATCCTTCACTCTGG - Intronic
1135161342 16:20099231-20099253 GCTTCCTGGAGCCTTGATCTAGG - Intergenic
1137797867 16:51237434-51237456 TCTTGCTGGATCCTGGACAGTGG + Intergenic
1138055659 16:53830594-53830616 CCTTCCTGGCTCCTTGTGGGAGG - Intronic
1138319323 16:56098459-56098481 CCTTCCTGGACTCTTGCCCCCGG - Intergenic
1139947237 16:70649709-70649731 CCTTCCTGGTTCCCTGGCCCTGG - Intronic
1141062301 16:80884686-80884708 CCCTGCTGGAACCTTGATCGTGG - Intergenic
1141355223 16:83339237-83339259 CCTTCCTTGATCCCTGAGAGAGG + Intronic
1141784603 16:86190712-86190734 CCTTCCAGGATCCCAGACAGCGG + Intergenic
1141863172 16:86731850-86731872 CCTTTCAGCATCCTTGACGGTGG - Intergenic
1143319134 17:6056661-6056683 CCTTTCTGGATCCTGGGCCTTGG + Intronic
1148645361 17:49217148-49217170 CCTTCCTGGATCCTTGACCGAGG + Intronic
1149264715 17:54914992-54915014 GCTTTCTGGAGCCTTGACTGTGG + Intronic
1150860667 17:68797188-68797210 CCTGCCTTGATCCTTCACCTTGG - Intergenic
1154099464 18:11456571-11456593 CCGTCCTGGAGCCTTCACAGAGG - Intergenic
1155819256 18:30353412-30353434 CCTTCCGGGATCCCAGACCTAGG + Intergenic
1156154345 18:34283722-34283744 CCTGCCTGGTTCCTGGACCAAGG + Intergenic
1158391494 18:57048947-57048969 CCTTCCTGGATCCTGGGCCGTGG - Intergenic
1159929051 18:74293620-74293642 CCTGCCTTGATCCTTCACCTTGG + Intergenic
1160004495 18:75059897-75059919 CCCGCCTGGTGCCTTGACCGAGG - Intronic
1160198977 18:76780468-76780490 CCTTCCTGGCACCTTGACCTTGG + Intergenic
1160578046 18:79868084-79868106 CCCTCCTGGATATTCGACCGAGG - Intronic
1160938362 19:1608590-1608612 CCTTCCTGGCCACTTGACGGGGG - Intergenic
1162490647 19:10989359-10989381 CCTTCCCGGGTCCCTGGCCGGGG + Exonic
1162817861 19:13207357-13207379 CCTTCCTGGAGCCCGGCCCGCGG + Exonic
1164004244 19:21134340-21134362 CCTGCCTTGATCCTTCACCTTGG - Intergenic
1164080622 19:21858869-21858891 CCTGCCTTGATCCTTCACCTTGG + Intergenic
1164219159 19:23177782-23177804 CCTGCCTTGATCCTTCACCTTGG + Intergenic
1166905981 19:46108674-46108696 CCTGCCTTGATCCTTCACCTTGG - Intergenic
1166917048 19:46202560-46202582 CCTGCCTTGATCCTTCACCTTGG - Intergenic
1167617416 19:50543081-50543103 CCTGCCCGGATCCTTGGCAGAGG - Intronic
1167719859 19:51171951-51171973 CCTTCCTGCATCCTTGGATGTGG - Intergenic
927130422 2:20053941-20053963 CCTCCCTGGTTCCTTGCCTGGGG - Intergenic
930099306 2:47590647-47590669 CCTGCCTTGATCCTTCACCTTGG - Intergenic
931047626 2:58374029-58374051 CCTTGCTGGAACCTTGATCTTGG - Intergenic
932852101 2:75197827-75197849 GCTTCCTGGATCCCTATCCGTGG + Intronic
934500659 2:94857953-94857975 CCTTTCTGGATCCTGGGCCCTGG + Intergenic
935697236 2:105780806-105780828 CCTTCCTGGTTCCTACACGGCGG - Intronic
935792800 2:106609492-106609514 CCTTCCTGGATCCTCAAGCTAGG - Intergenic
940182765 2:150954169-150954191 CCTGCCTTGATCCTTCACCTTGG + Intergenic
940726605 2:157342706-157342728 CCTGCCTTGATCCTTCACCTTGG - Intergenic
942483099 2:176410681-176410703 ACTTCCAGGATCCTTGAAAGGGG - Intergenic
947301277 2:228690440-228690462 CCTTCCTAGCTCCATGACCTTGG + Intergenic
948770366 2:240248604-240248626 CGTGCCTGGATCCCTGACCTGGG - Intergenic
1169404787 20:5314490-5314512 CCGTCCTGGATCCTGGAAGGAGG + Intergenic
1169605142 20:7309322-7309344 CCTTGCTGGAACCTTGATCTTGG - Intergenic
1171288692 20:23966867-23966889 CCTTCCTGGGTCCTGGCCCAGGG - Intergenic
1172594926 20:36144316-36144338 CCTGCCTGGTTCCTTGAGCCAGG + Intronic
1174060829 20:47831786-47831808 CCATCCAGGAACCTTCACCGTGG + Intergenic
1174071069 20:47899584-47899606 CCATCCAGGAACCTTCACCGTGG - Intergenic
1174100037 20:48120200-48120222 CCATCCAGGAACCTTCACCGTGG + Intergenic
1174152984 20:48499078-48499100 CCATCCAGGAACCTTCACCGTGG + Intergenic
1174359266 20:50017657-50017679 CCTTCCTGGCTCTGTGACCTTGG - Intergenic
1174801647 20:53568526-53568548 ACCTCCAGGATCCTTGACTGAGG - Exonic
1175187225 20:57186878-57186900 CTTTCCTGCATTCTTGAGCGGGG + Intronic
1178262290 21:31111064-31111086 CTTCCCTGGATCCATGACCCTGG + Intergenic
1178839070 21:36124110-36124132 ACTTCCTAGAACCTTGACCTTGG + Intergenic
1179403614 21:41107674-41107696 CCTTCCAGGAGCCTTTACCTTGG - Intergenic
1180837040 22:18935047-18935069 CCCTCCTGTCTCCTTGGCCGGGG + Intronic
1181064918 22:20300978-20301000 CCCTCCTGTCTCCTTGGCCGGGG - Intergenic
1183241196 22:36659491-36659513 CCTTCCTGGATTCATGAACTTGG - Intronic
1184409066 22:44316206-44316228 ACATCCTGCATCCTTGACCCAGG - Intergenic
1203287133 22_KI270734v1_random:160346-160368 CCCTCCTGTCTCCTTGGCCGGGG + Intergenic
950163611 3:10777773-10777795 CATTCCTGGTTCTTTGACCTTGG - Intergenic
954161978 3:48729342-48729364 CCTGCCTTGATCCTTCACCTTGG - Intronic
957591444 3:82204814-82204836 CCTTCCTGGATGCTGGACAAAGG - Intergenic
958487832 3:94734184-94734206 CCATCCTGGTACCTTGACCATGG - Intergenic
958561962 3:95759121-95759143 CCTTCCAGGATCCCAGACCTGGG - Intergenic
965009879 3:163073883-163073905 CCTTCTGGGAGCCTTGACCTTGG + Intergenic
967742801 3:193021735-193021757 GCTGCCTTGATCCTTGACTGAGG - Intergenic
968955935 4:3719417-3719439 CCTGCATGGAGCCCTGACCGTGG - Intergenic
969438062 4:7199898-7199920 CCTTGCTGGGTCCTTGCCTGAGG + Intronic
970274125 4:14379194-14379216 ACTTCCTGGTGCCTTGACCTTGG + Intergenic
970454502 4:16209209-16209231 CCTTCCTGGATCCTCGTCCCAGG + Intronic
972647063 4:40979012-40979034 CTTTCCTGGCTCCATGACCTTGG + Intronic
973044718 4:45521540-45521562 CCCTTCTGGATCCTTGATCTTGG - Intergenic
973712153 4:53640940-53640962 CCTTCCTCAATCCCTGGCCGGGG + Intronic
979596907 4:122544308-122544330 CCTGCCTGGTTCCTTGAACTAGG + Intergenic
985494770 5:198254-198276 CCTTACTGGAGCCTTGTCCAGGG + Exonic
994049731 5:95349019-95349041 CCTTCCTGGATCCCTGATGATGG + Intergenic
996052846 5:118951820-118951842 CCTGCCTTGATCCTTCACCTTGG - Intronic
996962342 5:129266157-129266179 CCTTTCTTTATCCTTGACCTTGG - Intergenic
997049982 5:130368448-130368470 CCTTCCTGATTCCTTGCCTGTGG + Intergenic
997897754 5:137735268-137735290 CTTTCCTGGCTCCTTTCCCGGGG - Intronic
998825644 5:146098612-146098634 CATTCCTGGAGGCTTGACCTTGG + Intronic
1000216168 5:159158788-159158810 CCTTCCTGTATCCTGGTCCCTGG + Exonic
1000830498 5:166095737-166095759 CATTCTTGGTTCCTTGACCCAGG - Intergenic
1001957320 5:175856904-175856926 CTTGCCTGGATCCTTCACTGCGG + Intronic
1003020993 6:2509381-2509403 TCTCCCTGGAAACTTGACCGTGG - Intergenic
1006536655 6:34704618-34704640 CCTTCCAGGAGACTTGACCCAGG + Intergenic
1006881256 6:37341932-37341954 CCTTCCTGATTCCTTCAGCGTGG + Intergenic
1012892303 6:104909941-104909963 CCTTTCTTTATCCTTGACCTTGG - Intergenic
1013739386 6:113265403-113265425 TCTTCCAGGACCCTTGACTGAGG - Intergenic
1018093158 6:160362880-160362902 CCCTCCTGGCTCCTTGGCCGCGG - Intronic
1018473231 6:164114691-164114713 CCTTCTTGGAGCTTTGACTGGGG + Intergenic
1018502426 6:164425462-164425484 CCATATTGGATCCTTGACCTAGG + Intergenic
1018917438 6:168144945-168144967 CCTTTCTTTATCCTTGACCTTGG + Intergenic
1019362290 7:611131-611153 TCTTCCTGGCTTCTTGACCTTGG - Intronic
1020434953 7:8152416-8152438 CATTACTGGAGCCTTTACCGTGG + Intronic
1024011601 7:45271599-45271621 CCTTTCAGCTTCCTTGACCGGGG + Intergenic
1029128861 7:98314728-98314750 CCTTCATGGGTCCGTGTCCGGGG - Intronic
1030752695 7:113249758-113249780 CCTTTCTTTATCCTTGACCTTGG - Intergenic
1035542613 8:453692-453714 CCTTCCCGGATCCCTGAGAGTGG + Intronic
1037602290 8:20407235-20407257 CCTTGCTGGCACCTTGATCGTGG + Intergenic
1039562278 8:38522276-38522298 CCTTCCTGAATCCTTAACCTTGG + Intronic
1043507089 8:80912838-80912860 CCTTTCTTGATCCTTCACCTTGG - Intergenic
1047650451 8:126914555-126914577 CCTTCCTGGAGGCCTGACTGTGG + Intergenic
1050140294 9:2510507-2510529 CCTGCCTTGATCCTTCACCTTGG + Intergenic
1050644068 9:7700656-7700678 CCTTTCTTTATCCTTGACCTTGG + Intergenic
1055450872 9:76430452-76430474 GCTCCCTGCATCCTTGACCTCGG + Intronic
1057468644 9:95338326-95338348 CCTTCCAGGATCCCAGACCTAGG + Intergenic
1060920084 9:127414403-127414425 CCTGCCTTGATCCTTCACCTTGG + Intergenic
1188068612 X:25693153-25693175 CCTTTCTTTATCCTTGACCTTGG + Intergenic
1188201183 X:27294098-27294120 CCTGCCTTGATCCTTCACCTTGG - Intergenic
1188548058 X:31332070-31332092 GCTTCCTAGCTCCTTGACCTTGG + Intronic
1190166480 X:48076976-48076998 CCTTTCTGGAACCTTGATCTTGG + Intergenic
1192067172 X:67897639-67897661 CCTTTCTTTATCCTTGACCTTGG - Intergenic
1192731828 X:73808568-73808590 CCTGCCTTGATCCTTCACCTTGG - Intergenic
1195421316 X:104678221-104678243 CCTTCCTGCAATCTAGACCGTGG + Intronic
1197819277 X:130529367-130529389 ACTTCCTGGATCCTGGGCAGTGG + Intergenic
1200810790 Y:7482526-7482548 CCTCCTTGGCTCCTTGACCTGGG + Intergenic
1201611228 Y:15845200-15845222 CCTTCCTGGGAGCTTGACCAGGG + Intergenic