ID: 1148646690

View in Genome Browser
Species Human (GRCh38)
Location 17:49223492-49223514
Sequence TTCACCAAAGTCACCCTCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148646690_1148646696 10 Left 1148646690 17:49223492-49223514 CCCGCGAGGGTGACTTTGGTGAA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1148646696 17:49223525-49223547 TCTTGCTGCATAGACGAGGCTGG 0: 1
1: 1
2: 4
3: 114
4: 1622
1148646690_1148646697 11 Left 1148646690 17:49223492-49223514 CCCGCGAGGGTGACTTTGGTGAA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1148646697 17:49223526-49223548 CTTGCTGCATAGACGAGGCTGGG 0: 1
1: 1
2: 0
3: 3
4: 95
1148646690_1148646698 19 Left 1148646690 17:49223492-49223514 CCCGCGAGGGTGACTTTGGTGAA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1148646698 17:49223534-49223556 ATAGACGAGGCTGGGATGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 249
1148646690_1148646695 6 Left 1148646690 17:49223492-49223514 CCCGCGAGGGTGACTTTGGTGAA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1148646695 17:49223521-49223543 GGTCTCTTGCTGCATAGACGAGG 0: 1
1: 1
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148646690 Original CRISPR TTCACCAAAGTCACCCTCGC GGG (reversed) Exonic
901625706 1:10623794-10623816 GCCACCAATGTCAGCCTCGCAGG - Intronic
907490653 1:54806886-54806908 TGCTCCAAAGTCACCTTCCCGGG + Intronic
915735245 1:158080533-158080555 TCCACCCAAGTCACCCAGGCAGG - Intronic
916889859 1:169105117-169105139 GTCCCCAAGGTCAACCTCGCTGG - Intergenic
918004977 1:180533614-180533636 TTCATTATAGTCACCCTGGCGGG + Intergenic
920347839 1:205317939-205317961 TTCATCAAAGCCAGCCTTGCTGG + Intronic
922195002 1:223352354-223352376 TTCAGCAAAGCCACTCTCGAGGG + Intronic
1063716200 10:8529412-8529434 TTCACCCATGTCACCCAGGCTGG - Intergenic
1065816673 10:29488717-29488739 TTCTCAGAAGTCACCCTGGCGGG - Exonic
1065956188 10:30695939-30695961 TTCTCAGAAGTCACCCTGGCGGG + Intergenic
1070605988 10:77898854-77898876 TCACCCAAAGTCACCCACGCCGG + Intronic
1075193969 10:120338695-120338717 TTCATAAAAGTCACCCTTTCTGG + Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077824766 11:5794493-5794515 TTCACCATTGTCACCCAGGCTGG + Intronic
1086061137 11:82701002-82701024 GGCACCAAAGTCACCTTCGATGG - Intergenic
1089967419 11:122664885-122664907 TTCTCCACAGTGACCCTCGGAGG + Intronic
1093945221 12:25100160-25100182 TTCACCATAGCCATCCTCGTGGG - Intronic
1097084961 12:56460712-56460734 TTCTCCAAAGTCACCTTCCTTGG - Intronic
1097382202 12:58908433-58908455 AACACCAAAGTCACCCTCAGTGG + Intronic
1097714827 12:62955013-62955035 TTCACCATAGCCACCCCCGTTGG + Intergenic
1098012653 12:66071227-66071249 TGCACCAGAGTCCCCCTCCCTGG - Intergenic
1098503934 12:71227083-71227105 TTCACCATAGCCACCATAGCAGG - Intronic
1099093200 12:78339587-78339609 GTCACCAAAGTCAACCTTGGAGG + Intergenic
1099286292 12:80717131-80717153 GTCCCCAAATTCACCCTCGGGGG - Exonic
1102165164 12:110800365-110800387 TTTACCAAATTCTCCCTCTCTGG + Intergenic
1105984714 13:25554072-25554094 TTCCCCAAAAACACCCTCACTGG - Intronic
1106197567 13:27507427-27507449 CTCACCTAAGTCAGCCTCCCAGG + Intergenic
1108962153 13:56247515-56247537 TTCACCACAGACACCATAGCTGG + Intergenic
1109211257 13:59538293-59538315 TTCACCATAGCCACCATAGCTGG + Intergenic
1118372789 14:65152127-65152149 CTCACCTAAGTCACCCTCCTTGG - Intergenic
1118855817 14:69621382-69621404 TTCACCAAGTTCACCCTGTCTGG + Intronic
1123000380 14:105290811-105290833 AACACCACAGTCACCCTCCCTGG + Intronic
1124705834 15:31963468-31963490 TCCACTAAAATCACCCTGGCTGG + Intergenic
1125415254 15:39445442-39445464 ATCACTAAAGTCACCCTTGCAGG - Intergenic
1129750357 15:78058666-78058688 TTCACCAAAGACACGCCCGCCGG + Intronic
1129879339 15:78996639-78996661 TTGATCAAAGCCACCCTCGGAGG - Intronic
1131387482 15:92019131-92019153 ATGAGCAAAGTCACCCTGGCAGG - Intronic
1133279953 16:4659574-4659596 CTCACCAAAGGCCCCCTGGCGGG - Intronic
1133652380 16:7824824-7824846 TTCACCAAAGTGTCCTTGGCTGG + Intergenic
1136590129 16:31213737-31213759 CTGACCAAGGTCACCCTGGCAGG - Intergenic
1137611653 16:49822149-49822171 TTTGCCTAAGTCACCCCCGCAGG + Intronic
1139415752 16:66807931-66807953 CTCACCACAGTCACCCAGGCTGG + Intronic
1140510354 16:75503069-75503091 TTCACCCACCTCACCCTCCCTGG - Intergenic
1146782337 17:35685956-35685978 TTCACCAATGTTAGCCACGCTGG + Intronic
1148646690 17:49223492-49223514 TTCACCAAAGTCACCCTCGCGGG - Exonic
1148794011 17:50188623-50188645 CTCACCACGGTCACCCTGGCGGG + Exonic
1150225935 17:63524425-63524447 TTCCCCAAGGCCACCCTGGCTGG - Intronic
1151344183 17:73491752-73491774 TGTTCCAAAGTCACCCTTGCGGG + Intronic
1155354676 18:24940789-24940811 TTCACCAAAGTGCCCCTCGTAGG + Intergenic
1155464029 18:26115627-26115649 TTCACCATAGTCATTCTCACTGG - Intergenic
1156426464 18:37019172-37019194 TTCTCCACAGTCACACTCGGAGG - Intronic
1158304777 18:56093202-56093224 TTCAACAAAGTAACCATAGCAGG - Intergenic
1159674122 18:71260609-71260631 TTCAGCAAAGTCACCCAAGGCGG - Intergenic
925916099 2:8607468-8607490 CTCACCTCAGACACCCTCGCAGG + Intergenic
927392660 2:22612516-22612538 CTCAACAAAGTCACCCACTCAGG + Intergenic
929666287 2:43836608-43836630 TTCACCACAGGGACCCTCCCAGG + Intronic
933289781 2:80425079-80425101 GTCACTCCAGTCACCCTCGCCGG - Intronic
934517812 2:94999668-94999690 TGGACCAGAGTCACCCTGGCTGG + Intergenic
936049049 2:109209286-109209308 GTCACCAAAATCACCCGCGCAGG - Intronic
940837055 2:158534060-158534082 TTCAACAAAATAACCCTCACAGG - Intronic
942916958 2:181321940-181321962 TTCACCAAAGTCATTCTCCTTGG - Intergenic
944530840 2:200666592-200666614 TATACCAAAGTCAGCCTGGCAGG + Intronic
945220809 2:207482052-207482074 TTCTCCACAGTCATCCTGGCTGG - Intergenic
948399511 2:237673520-237673542 TTCCTCACAGTTACCCTCGCTGG + Intronic
1170907445 20:20528730-20528752 TGCACCTAGGTCACCCTTGCAGG + Intronic
1172123414 20:32611504-32611526 CTCCCCAAGGTCACCCTCACAGG + Intergenic
1172912518 20:38420534-38420556 TTCTCCAAAGCCAGCCTGGCAGG + Intergenic
1173161060 20:40652960-40652982 TGCTGCAAAGTCCCCCTCGCTGG - Intergenic
1175155267 20:56967108-56967130 TTCTCCAAAGTCACATTCACAGG + Intergenic
1176109967 20:63406671-63406693 GTCACCAAAGGGACCCTCGCCGG + Exonic
1179141298 21:38727747-38727769 CTTACCACAGTCACCCTTGCTGG + Intergenic
1179359659 21:40693998-40694020 TTCACCACAGTCACCCTAGGGGG - Intronic
1181091308 22:20474497-20474519 TTCTCCAAACTCAGCCTCCCGGG + Intronic
1182116127 22:27757561-27757583 CTCGCCCAACTCACCCTCGCTGG + Intronic
1182674890 22:32031399-32031421 TTCCCCAAGGACACCCTCTCTGG - Intergenic
1184762140 22:46550685-46550707 TTCACCAAACTCCCCCTCCATGG - Intergenic
951670109 3:25171686-25171708 TTCAGCAAATCCACCCCCGCAGG - Intergenic
953551664 3:43908173-43908195 TGCACCCAAGTCCCCCTCTCAGG - Intergenic
956288798 3:67639681-67639703 TTAAGCAAAGTCACCCTCTTTGG + Intronic
958073384 3:88643310-88643332 TTCAACAAAGTCAGCCTACCGGG + Intergenic
965750296 3:171968857-171968879 TTCTCAAAAGTCAACCTCGGTGG + Intergenic
972506782 4:39727388-39727410 TACACCACAGTCACCCAGGCAGG + Intronic
978738874 4:112115119-112115141 TTCAGCAAAGTCAGCTTCTCTGG - Intergenic
979213291 4:118132637-118132659 TTCACCATAGTCACCACTGCTGG + Intronic
984855733 4:184194618-184194640 CTCACCAGGGCCACCCTCGCGGG - Intronic
985866049 5:2515457-2515479 TGCACCACAGGCATCCTCGCAGG + Intergenic
987797076 5:22641492-22641514 TCCTCCAGAGTCACCCTCACAGG + Intronic
988638056 5:33008892-33008914 TTGACCCAAGTCACGCTCCCTGG - Intergenic
996192556 5:120563829-120563851 TTCACCATAGCCACCATAGCTGG + Intronic
998652772 5:144140226-144140248 TTCACCCAAATCACCCACGCAGG - Intergenic
998710000 5:144813392-144813414 TTCACCTAAGTGAGCCTAGCTGG - Intergenic
998741147 5:145203437-145203459 TTCATTAATGTCACCCTCCCAGG + Intergenic
1000118919 5:158178403-158178425 TTAGCCAATGTCACCCTCCCAGG + Intergenic
1002402851 5:179001555-179001577 GTGACCAGAGTCAGCCTCGCGGG + Intergenic
1002402862 5:179001611-179001633 GTGACCAGAGTCAGCCTCGCGGG + Intergenic
1002402873 5:179001667-179001689 GTGACCAGAGTCAGCCTCGCGGG + Intergenic
1006018636 6:31103441-31103463 TTCACCATAGCCACCATAGCTGG + Intergenic
1014101093 6:117512676-117512698 TTGACCTAAGTGACCCTCCCTGG - Intronic
1016083076 6:139879047-139879069 TTCAACACAGTCACTCTCCCAGG - Intergenic
1017385771 6:153880928-153880950 TTCATAAAAGTCAGCCTCCCAGG + Intergenic
1017404764 6:154107348-154107370 TTCACCAAAGGCAACCTCCTTGG + Intronic
1018260994 6:161970565-161970587 TTCACTATTGTCACCCTGGCTGG + Intronic
1019255137 7:44855-44877 TTCATAAAAGTCACCCTCTGTGG + Intergenic
1023044415 7:36198810-36198832 TTCACCAGAGTGACCGTGGCTGG - Intronic
1028522013 7:91742333-91742355 TTCACCATAGCCACCATAGCTGG + Intronic
1030336484 7:108333468-108333490 CTCACCAAAATCACCCTAGCTGG + Intronic
1040434745 8:47379498-47379520 TTCACCCAATTCACCCAGGCTGG - Intronic
1048448299 8:134509623-134509645 TTAACCACAGTCACCGTCCCTGG + Exonic
1049799412 8:144510841-144510863 GTCACCACAGTCACCTTCACTGG + Exonic
1050644300 9:7702577-7702599 TTCACCATAGCCACCATAGCTGG + Intergenic
1055171393 9:73263093-73263115 TTCAGCAAAGTGACCCTCTGAGG + Intergenic
1058751779 9:108046163-108046185 GTCACCGAAGTCACCCTCATTGG + Intergenic
1062516148 9:136937554-136937576 CTAACCAAAGACACCCACGCAGG - Intronic
1188027621 X:25226803-25226825 TTCACCATAGTCACCATACCTGG - Intergenic
1193463497 X:81818173-81818195 CTCACCAAAGCCACCATAGCTGG + Intergenic
1201853647 Y:18516898-18516920 TTAACTAAAGTCACACTCCCGGG + Intergenic
1201879674 Y:18803486-18803508 TTAACTAAAGTCACACTCCCGGG - Intronic
1201953507 Y:19593070-19593092 TTCCCAAAAGTCATCCTCACTGG - Intergenic