ID: 1148651042

View in Genome Browser
Species Human (GRCh38)
Location 17:49250190-49250212
Sequence GAGAAAACTGAGCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148651042_1148651045 -10 Left 1148651042 17:49250190-49250212 CCTCCCTGGGGCTCAGTTTTCTC No data
Right 1148651045 17:49250203-49250225 CAGTTTTCTCATCTCTCACATGG No data
1148651042_1148651046 -9 Left 1148651042 17:49250190-49250212 CCTCCCTGGGGCTCAGTTTTCTC No data
Right 1148651046 17:49250204-49250226 AGTTTTCTCATCTCTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148651042 Original CRISPR GAGAAAACTGAGCCCCAGGG AGG (reversed) Intergenic