ID: 1148656461

View in Genome Browser
Species Human (GRCh38)
Location 17:49287405-49287427
Sequence AATCCCGCTACTCAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148656461_1148656464 -4 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656464 17:49287424-49287446 GATTACAGGTGCCCACCACCAGG No data
1148656461_1148656472 29 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656472 17:49287457-49287479 TTTGTATTTTTAGTAGAGATGGG No data
1148656461_1148656473 30 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG No data
1148656461_1148656465 1 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG No data
1148656461_1148656471 28 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656471 17:49287456-49287478 TTTTGTATTTTTAGTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148656461 Original CRISPR AATCCCGCTACTCAGGAGAC TGG (reversed) Intergenic