ID: 1148656461

View in Genome Browser
Species Human (GRCh38)
Location 17:49287405-49287427
Sequence AATCCCGCTACTCAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148656461_1148656472 29 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656472 17:49287457-49287479 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
1148656461_1148656473 30 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1148656461_1148656465 1 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG 0: 109
1: 5518
2: 23681
3: 56113
4: 87699
1148656461_1148656464 -4 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656464 17:49287424-49287446 GATTACAGGTGCCCACCACCAGG 0: 126
1: 425
2: 1219
3: 2277
4: 3943
1148656461_1148656471 28 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656471 17:49287456-49287478 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148656461 Original CRISPR AATCCCGCTACTCAGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr