ID: 1148656464

View in Genome Browser
Species Human (GRCh38)
Location 17:49287424-49287446
Sequence GATTACAGGTGCCCACCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7990
Summary {0: 126, 1: 425, 2: 1219, 3: 2277, 4: 3943}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148656461_1148656464 -4 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656464 17:49287424-49287446 GATTACAGGTGCCCACCACCAGG 0: 126
1: 425
2: 1219
3: 2277
4: 3943
1148656456_1148656464 2 Left 1148656456 17:49287399-49287421 CCTACCCCAGTCTCCTGAGTAGC 0: 25
1: 1152
2: 19661
3: 118592
4: 212934
Right 1148656464 17:49287424-49287446 GATTACAGGTGCCCACCACCAGG 0: 126
1: 425
2: 1219
3: 2277
4: 3943
1148656460_1148656464 -3 Left 1148656460 17:49287404-49287426 CCCAGTCTCCTGAGTAGCGGGAT No data
Right 1148656464 17:49287424-49287446 GATTACAGGTGCCCACCACCAGG 0: 126
1: 425
2: 1219
3: 2277
4: 3943
1148656459_1148656464 -2 Left 1148656459 17:49287403-49287425 CCCCAGTCTCCTGAGTAGCGGGA No data
Right 1148656464 17:49287424-49287446 GATTACAGGTGCCCACCACCAGG 0: 126
1: 425
2: 1219
3: 2277
4: 3943
1148656455_1148656464 21 Left 1148656455 17:49287380-49287402 CCTGGGTTCAAGTGATTCTCCTA 0: 1184
1: 39305
2: 112874
3: 177587
4: 236080
Right 1148656464 17:49287424-49287446 GATTACAGGTGCCCACCACCAGG 0: 126
1: 425
2: 1219
3: 2277
4: 3943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148656464 Original CRISPR GATTACAGGTGCCCACCACC AGG Intergenic
Too many off-targets to display for this crispr