ID: 1148656465

View in Genome Browser
Species Human (GRCh38)
Location 17:49287429-49287451
Sequence CAGGTGCCCACCACCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173120
Summary {0: 109, 1: 5518, 2: 23681, 3: 56113, 4: 87699}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148656456_1148656465 7 Left 1148656456 17:49287399-49287421 CCTACCCCAGTCTCCTGAGTAGC 0: 25
1: 1152
2: 19661
3: 118592
4: 212934
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG 0: 109
1: 5518
2: 23681
3: 56113
4: 87699
1148656460_1148656465 2 Left 1148656460 17:49287404-49287426 CCCAGTCTCCTGAGTAGCGGGAT No data
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG 0: 109
1: 5518
2: 23681
3: 56113
4: 87699
1148656459_1148656465 3 Left 1148656459 17:49287403-49287425 CCCCAGTCTCCTGAGTAGCGGGA No data
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG 0: 109
1: 5518
2: 23681
3: 56113
4: 87699
1148656461_1148656465 1 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG 0: 109
1: 5518
2: 23681
3: 56113
4: 87699
1148656463_1148656465 -6 Left 1148656463 17:49287412-49287434 CCTGAGTAGCGGGATTACAGGTG 0: 15
1: 188
2: 869
3: 8328
4: 99433
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG 0: 109
1: 5518
2: 23681
3: 56113
4: 87699
1148656455_1148656465 26 Left 1148656455 17:49287380-49287402 CCTGGGTTCAAGTGATTCTCCTA 0: 1184
1: 39305
2: 112874
3: 177587
4: 236080
Right 1148656465 17:49287429-49287451 CAGGTGCCCACCACCAGGCCTGG 0: 109
1: 5518
2: 23681
3: 56113
4: 87699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148656465 Original CRISPR CAGGTGCCCACCACCAGGCC TGG Intergenic
Too many off-targets to display for this crispr