ID: 1148656473

View in Genome Browser
Species Human (GRCh38)
Location 17:49287458-49287480
Sequence TTGTATTTTTAGTAGAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 602883
Summary {0: 82079, 1: 170980, 2: 171502, 3: 107694, 4: 70628}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148656461_1148656473 30 Left 1148656461 17:49287405-49287427 CCAGTCTCCTGAGTAGCGGGATT No data
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1148656466_1148656473 0 Left 1148656466 17:49287435-49287457 CCCACCACCAGGCCTGGCTAATT 0: 183
1: 9438
2: 40316
3: 73005
4: 82183
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1148656467_1148656473 -1 Left 1148656467 17:49287436-49287458 CCACCACCAGGCCTGGCTAATTT 0: 446
1: 21117
2: 48906
3: 65258
4: 42689
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1148656463_1148656473 23 Left 1148656463 17:49287412-49287434 CCTGAGTAGCGGGATTACAGGTG 0: 15
1: 188
2: 869
3: 8328
4: 99433
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1148656469_1148656473 -7 Left 1148656469 17:49287442-49287464 CCAGGCCTGGCTAATTTTGTATT 0: 129
1: 6651
2: 13952
3: 26912
4: 64273
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1148656468_1148656473 -4 Left 1148656468 17:49287439-49287461 CCACCAGGCCTGGCTAATTTTGT 0: 134
1: 7987
2: 46898
3: 130640
4: 188284
Right 1148656473 17:49287458-49287480 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148656473 Original CRISPR TTGTATTTTTAGTAGAGATG GGG Intergenic
Too many off-targets to display for this crispr