ID: 1148664987

View in Genome Browser
Species Human (GRCh38)
Location 17:49367792-49367814
Sequence AAGTAGGGCTGGTGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148664987_1148664997 22 Left 1148664987 17:49367792-49367814 CCCACCTCCCACCAGCCCTACTT No data
Right 1148664997 17:49367837-49367859 AATGCCAGGACCAGGCACAGTGG No data
1148664987_1148664995 8 Left 1148664987 17:49367792-49367814 CCCACCTCCCACCAGCCCTACTT No data
Right 1148664995 17:49367823-49367845 GTAAATAGTAATTAAATGCCAGG No data
1148664987_1148664996 14 Left 1148664987 17:49367792-49367814 CCCACCTCCCACCAGCCCTACTT No data
Right 1148664996 17:49367829-49367851 AGTAATTAAATGCCAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148664987 Original CRISPR AAGTAGGGCTGGTGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr