ID: 1148666157

View in Genome Browser
Species Human (GRCh38)
Location 17:49376596-49376618
Sequence AGCCCAGAGCTGTAAGGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148666155_1148666157 -7 Left 1148666155 17:49376580-49376602 CCGACAGGTTGACTTAAGCCCAG 0: 1
1: 0
2: 2
3: 54
4: 306
Right 1148666157 17:49376596-49376618 AGCCCAGAGCTGTAAGGTAATGG 0: 1
1: 0
2: 0
3: 8
4: 149
1148666151_1148666157 15 Left 1148666151 17:49376558-49376580 CCCTAGATGGAACACAAACCTGC 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1148666157 17:49376596-49376618 AGCCCAGAGCTGTAAGGTAATGG 0: 1
1: 0
2: 0
3: 8
4: 149
1148666152_1148666157 14 Left 1148666152 17:49376559-49376581 CCTAGATGGAACACAAACCTGCC 0: 1
1: 0
2: 1
3: 22
4: 174
Right 1148666157 17:49376596-49376618 AGCCCAGAGCTGTAAGGTAATGG 0: 1
1: 0
2: 0
3: 8
4: 149
1148666154_1148666157 -3 Left 1148666154 17:49376576-49376598 CCTGCCGACAGGTTGACTTAAGC 0: 1
1: 0
2: 0
3: 14
4: 231
Right 1148666157 17:49376596-49376618 AGCCCAGAGCTGTAAGGTAATGG 0: 1
1: 0
2: 0
3: 8
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148666157 Original CRISPR AGCCCAGAGCTGTAAGGTAA TGG Intronic
900825329 1:4921473-4921495 TGCCCAGTGCAATAAGGTAATGG - Intergenic
904141069 1:28353456-28353478 AGCCCAGAGCTGGAGTGCAATGG - Intergenic
905274295 1:36807119-36807141 AGCCCAGGGCTGTAGGGTCCTGG + Intronic
906813799 1:48856640-48856662 AGCCCAGAGTTGTCATGTACTGG + Intronic
907661310 1:56394905-56394927 GGCCCAGAGCTGCACGGTACAGG - Intergenic
908148108 1:61268764-61268786 AGCCCAGAGCTCCCAGGAAAAGG - Intronic
909349911 1:74639423-74639445 AGCTCACAGCTGTTAGTTAATGG - Intronic
911059340 1:93734394-93734416 AGGCCTGAGCTGGAAGGAAATGG + Intronic
911543686 1:99189783-99189805 AGGCCAGAGCTGAGAGGTACGGG + Intergenic
912553359 1:110498726-110498748 AGTCCACAGCTGTGAGGTGATGG + Intergenic
915731288 1:158056186-158056208 AGCCCAGAGGTGAAAGGGAATGG - Intronic
918564486 1:185912241-185912263 AGCCCAATTCTGTAAAGTAAAGG - Intronic
919754451 1:201058159-201058181 AGGCAAGAGCTGTAACGGAAAGG - Intronic
922607089 1:226896305-226896327 AGCCCTGAGCTGTAAGGCTGTGG + Intergenic
922776015 1:228214506-228214528 AGCCCAGAGAGCTGAGGTAATGG - Intronic
1063769174 10:9177834-9177856 AGCCTATATCTGAAAGGTAATGG - Intergenic
1064027159 10:11857972-11857994 TGCCCAGAGCTGGAATGCAATGG + Intronic
1066522965 10:36243265-36243287 AGCCCGGGGCTGTAAAGGAAAGG + Intergenic
1068213570 10:53953019-53953041 AGCCCAGAGCTCTCAGGTGCAGG - Intronic
1069635767 10:69923872-69923894 ATCCCAGAGCTGCAAGATGAGGG + Intronic
1072804189 10:98414432-98414454 GTCCCAGAGCTGCAAGGCAATGG + Intronic
1073036704 10:100568958-100568980 AACCCACAGCTGAAAGCTAAAGG + Intergenic
1073263795 10:102210753-102210775 TGCCTAGAGCTGTTAGGTGAGGG - Intergenic
1073449578 10:103601628-103601650 ATCCCACAGCTGGAAGGTAGGGG - Exonic
1074394494 10:113086379-113086401 AGCCCAGAACTGGAAGGAGATGG - Intronic
1080316689 11:30957882-30957904 AGGCCATAGGTGTAAGTTAAGGG - Intronic
1083148169 11:60773787-60773809 AGCCCAGAGTTCTAGAGTAAGGG - Intronic
1083235243 11:61346755-61346777 AGCCCAGAGCTGGCAGGGGAGGG - Exonic
1084369978 11:68734908-68734930 AGACCAGAGCAGTGAGGTGAGGG - Intronic
1087168074 11:95024085-95024107 AGCCCTGAGCTGCAACGTAGGGG + Intergenic
1094720658 12:33059713-33059735 AGCAAAGAGCTTTTAGGTAATGG - Intergenic
1095709593 12:45274253-45274275 AGCCGACAGCTGTAAAGCAAGGG - Intronic
1100498273 12:95146130-95146152 AGCACACAGCTGTCAGGAAATGG - Intronic
1102207634 12:111101259-111101281 TGCCCTGAGCTGTGTGGTAAGGG + Intronic
1103332345 12:120163021-120163043 AGCCCAGAGCTTTAGGGGATGGG - Intronic
1109062085 13:57632526-57632548 ATCCCAGACCTGTAAGGTGGGGG - Exonic
1110927886 13:81178924-81178946 AGCCCAGAGCAGTAAGACAAAGG - Intergenic
1114298236 14:21349899-21349921 ATCCCAGCTATGTAAGGTAATGG - Intronic
1116343413 14:43755430-43755452 AGCCCTGATCAGTAGGGTAACGG + Intergenic
1117060840 14:51961495-51961517 AGCCCAGAGCCTAAAGGGAAAGG + Intronic
1118294885 14:64559614-64559636 AGCCCAGACCTGCAAGGGCATGG + Intronic
1120811107 14:88804197-88804219 AGCCCAGGGCAGTGAGGTTAAGG + Intergenic
1122575269 14:102737961-102737983 AGCCCAGAGTTGGTGGGTAAAGG - Intergenic
1123217436 14:106824215-106824237 ATCCCAGAACTGTAGGGTGAGGG + Intergenic
1125705587 15:41732799-41732821 AGGCAAGAGCTGTAGGATAATGG - Intronic
1128458837 15:67850792-67850814 AGACCACAGCTGTCAGTTAAAGG + Intergenic
1128940062 15:71780718-71780740 GGGCCAGAGAGGTAAGGTAAAGG - Exonic
1129463040 15:75709520-75709542 GGCCCAGATCTTTAAGGTAGGGG + Intronic
1129622507 15:77161300-77161322 AGACCAAACCAGTAAGGTAAGGG - Intronic
1129721845 15:77881882-77881904 GGCCCAGATCTTTAAGGTAGGGG - Intergenic
1133971012 16:10568025-10568047 AGCCCAGAGCTATAGAATAAAGG + Intronic
1136060397 16:27722468-27722490 AGCCCAGAGAAGGAAGGAAAGGG - Intronic
1136122831 16:28150954-28150976 AGCTCAGAGGTGTCAGGTAGAGG - Intronic
1142005955 16:87689729-87689751 AGCCCCGAGCTGTACCGCAAGGG + Exonic
1142286980 16:89175504-89175526 TGCCCAGAGCTGGGAGGTGAAGG + Intronic
1143891371 17:10105064-10105086 AGCACAGAGCTAGAAGGTCAGGG - Intronic
1144842678 17:18197844-18197866 AGCACAGAGCTGTGGTGTAAGGG + Intronic
1145750072 17:27349283-27349305 AGCCCAGCGCCGTAAGGGAGAGG + Intergenic
1146949091 17:36893370-36893392 AGCCCAGAGCTCCCAGGGAATGG + Intergenic
1146949846 17:36898323-36898345 AGCCCAGAGCTCCCAGGGAATGG - Intergenic
1148083099 17:44978204-44978226 AGTCCAGAGCTGTGAGGAAGTGG - Intergenic
1148380248 17:47191508-47191530 TGCCCAGAGCTGGAGTGTAATGG + Intergenic
1148666157 17:49376596-49376618 AGCCCAGAGCTGTAAGGTAATGG + Intronic
1150260119 17:63782236-63782258 CGCCCAGAGCTGGAGGGCAATGG - Intronic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1155089343 18:22491188-22491210 AGCCTAGAGCTCTAATGTACAGG - Intergenic
1155669122 18:28348168-28348190 TGCCCAAAGCTGTAGGGTTACGG + Intergenic
1156511660 18:37641820-37641842 AGGCCAGAGCTGTAAGGAATGGG + Intergenic
1161175112 19:2837399-2837421 TGCCCAGAGCTGGAGTGTAATGG - Intergenic
1162349045 19:10137825-10137847 GGACCACATCTGTAAGGTAATGG - Exonic
1163400834 19:17091600-17091622 AGCCCAGAGCTGTGGGTGAAAGG + Intronic
1163770168 19:19186227-19186249 AGCCCAGACCTGTGAGGGAAGGG - Intronic
926701154 2:15804558-15804580 AGGCCAGAGCTGAGGGGTAAAGG + Intergenic
928124635 2:28607047-28607069 AGCCCAGAGCTGTATGGAGGAGG + Intronic
928603964 2:32927146-32927168 AGCCCACAGCTGTCAGGTGCAGG - Intergenic
933616427 2:84486543-84486565 AGCCCAGAGTGGTAAGATTAAGG - Intergenic
936610907 2:114001168-114001190 ATCCCAGAGCTGAGAGATAAAGG + Intergenic
937457517 2:122055241-122055263 AGCACAGGGCTGTAGGGTACAGG + Intergenic
937736168 2:125293435-125293457 AGCACAGAAATATAAGGTAAAGG - Intergenic
945600428 2:211856292-211856314 AGCCCAGAGCTGTGAAGTCTGGG + Intronic
945992375 2:216406893-216406915 AGCACAGAGGAGTAATGTAAAGG - Intergenic
1172766801 20:37355409-37355431 TGCCCACAGCTCTAAGGTATGGG - Intronic
1175871725 20:62212500-62212522 AGCCGAGAGCTGTCTGGGAAAGG - Intergenic
1176383012 21:6122771-6122793 CGCCCAGACCTGCCAGGTAAGGG - Exonic
1177238321 21:18422804-18422826 AGCCCAGAGCTATACAGAAAAGG - Intronic
1178698746 21:34816253-34816275 AGCCCAGAGCTGCAGAGAAAGGG - Intronic
1179488828 21:41727513-41727535 GGCCCTGAGCTGTAAGGGGAGGG + Intergenic
1179740457 21:43415468-43415490 CGCCCAGACCTGCCAGGTAAGGG + Exonic
1182597939 22:31436504-31436526 AGCCCAGAGGAGAAAGGGAAAGG - Intronic
1183742993 22:39678670-39678692 AGCCCAGGGCGGGAAGGTGATGG + Intronic
1183966003 22:41443357-41443379 AGCCCAGAGCTGGAGTGCAATGG + Intronic
1184013158 22:41764796-41764818 AGCAAAGAGCTCTAAGGTATTGG - Intronic
949536800 3:5002589-5002611 AGGCCAGGGCTGGAAGGTAGGGG - Intergenic
949573313 3:5313972-5313994 AGCCTAGAGCCGGAAGCTAAAGG - Intergenic
950458066 3:13104416-13104438 AGCCCAGAAATGTAAGGGATGGG - Intergenic
951534775 3:23730602-23730624 AGCCCAGAGATGTAGAGTGATGG - Intergenic
953342027 3:42142470-42142492 GCCCCAGGGCTGTAAGGTGACGG - Intronic
953815787 3:46155048-46155070 AGCTAAGAGCTGAAGGGTAATGG - Intergenic
956202660 3:66722477-66722499 AGCCCAGGGCTTTAAAGAAATGG - Intergenic
960164725 3:114388515-114388537 AGGCCAGAGCTCCAAGGGAAGGG + Intronic
963188702 3:142445719-142445741 AGACCAGAGCCCTAAGGAAAAGG - Intronic
965658848 3:171019402-171019424 AGCCTAGAGTTGTAGGATAAGGG + Intronic
966998327 3:185307581-185307603 CGCCCAGAGCTGTAGTGCAATGG + Intronic
967316181 3:188154006-188154028 AGCCGGGCGCTGCAAGGTAAGGG + Intronic
968842511 4:3017966-3017988 TGGCCAGTGCAGTAAGGTAAAGG + Intronic
969897106 4:10315715-10315737 AGCCAAGAGCTGTGAAGGAAAGG - Intergenic
972666049 4:41166340-41166362 AGCCCAGAGCTGTATTCTATGGG + Intronic
977545781 4:98374822-98374844 AGCCCACAGCTGTGCGGGAACGG - Intronic
980075965 4:128293107-128293129 AGCCCACAGGGTTAAGGTAATGG + Intergenic
984123998 4:175782436-175782458 TACCCAGCCCTGTAAGGTAAAGG + Intronic
984702318 4:182826147-182826169 AGCCCTGGGCTGGAAGATAATGG + Intergenic
986487497 5:8253006-8253028 AGCACTCAGCTGTAAGGTACCGG + Intergenic
988557251 5:32247870-32247892 AGCCCAGGGCTGTGATGTCATGG - Intronic
988737305 5:34035378-34035400 AGCCCAGAGCAGTAAGCTTTTGG + Intronic
990014501 5:51043231-51043253 AGCCCAGACCTGTAGGTTAGTGG + Intergenic
991395824 5:66204258-66204280 ATTCCAAAGCTGTAAAGTAAAGG - Intergenic
992181729 5:74204167-74204189 AGCCCATATCTATAAGGTAAGGG + Intergenic
994202109 5:96988685-96988707 AGCCCAGAACTTTAATGTTACGG - Intronic
997627543 5:135341321-135341343 AGCCCAGAGATGTGAGGCCAGGG + Intronic
1002093744 5:176818927-176818949 AGCCCTGAGCTTTAAGCCAAAGG + Intronic
1003922622 6:10847269-10847291 ATCCCAGAATTGTAGGGTAAAGG + Intronic
1004965067 6:20839630-20839652 AGACGAGAGCTGTAAGACAAGGG - Intronic
1005771168 6:29073183-29073205 AGCACACAGCTGAAAGGAAATGG + Intronic
1008477624 6:51949404-51949426 AGCACAGTGCAGTAAGGTACAGG - Intronic
1010739049 6:79478440-79478462 ATCCCAGAGTTATAAAGTAATGG - Intergenic
1011146084 6:84218336-84218358 AGCCCAGAGCAGGAAGTCAATGG + Intronic
1016462515 6:144291896-144291918 AGTCCAGATCTGGTAGGTAAAGG + Exonic
1017068315 6:150550130-150550152 AGCCCAGGGCAGGAAGGGAAGGG - Intergenic
1018647310 6:165960649-165960671 AGCGCAGATCTGTACGGCAAGGG + Intronic
1019920192 7:4158328-4158350 AGCCCAGAGCTCTCAGGGCAGGG + Intronic
1021575037 7:22099096-22099118 AGCCCAGAGTGGTAGGATAAGGG + Intergenic
1022865981 7:34420752-34420774 AGCCCAGATATGTAAGTTGATGG + Intergenic
1033620033 7:143053507-143053529 AGCCCAGAGCTTTCAGTAAAGGG + Intergenic
1037252481 8:16912870-16912892 AGCCCAGAGCAGTAAGACACTGG + Intergenic
1037404583 8:18528199-18528221 AGATCAGAGCTGTTAGGTAAAGG - Exonic
1037773141 8:21814852-21814874 AGCCCAGAAATGACAGGTAAAGG - Intergenic
1038718386 8:30011941-30011963 AGCCCAGAGCTGAAGGGAAGAGG + Intergenic
1039241041 8:35557209-35557231 AGCTCAGAGGTGTCTGGTAAAGG - Intronic
1045266705 8:100624877-100624899 AGCCCAGAGCTTTGAGGCTACGG - Intronic
1045868410 8:106896590-106896612 AACCCAGAGCTGGAAATTAAGGG + Intergenic
1052144665 9:25034073-25034095 AAGCCAGTGCTGTTAGGTAAGGG + Intergenic
1054823575 9:69548219-69548241 AGCCCACAGCTGCATGGAAATGG + Intronic
1055349689 9:75373508-75373530 AGCCCAGTGATGTAAGATAATGG - Intergenic
1058303078 9:103399901-103399923 AGAACAGAGTTGGAAGGTAAAGG - Intergenic
1059710627 9:116864691-116864713 GGCCCAGAGCTGTGAAGCAAGGG + Intronic
1060662314 9:125411501-125411523 ACCCCAGAGCTGCAAGGTGAGGG + Intergenic
1060835551 9:126752954-126752976 AGCCCAGAGGTGTCAGGTTGGGG - Intergenic
1061317288 9:129804184-129804206 AGCCCAGCCGTGTAAGGAAAGGG - Exonic
1061652162 9:132059508-132059530 AGCTCAGAGCTGGCAGGTGATGG + Intronic
1185547446 X:956662-956684 AGCCCTGAGCTGTCAGGAGAGGG - Intergenic
1186497283 X:10021709-10021731 GACCCAGAGCTGTCATGTAAGGG + Intronic
1188967029 X:36567145-36567167 AGCCCAGAGCAGAAAGGAACAGG - Intergenic
1192153628 X:68727053-68727075 AGTCCAGAGCTGCAAGGTTGGGG - Intergenic
1192788098 X:74354241-74354263 AGCCCAGTGCTGTAGGGGCAGGG - Intergenic
1194505938 X:94733428-94733450 ATCCCAAAGCTGTGAGGGAAGGG + Intergenic
1196348450 X:114697091-114697113 AACCCAGAGCTGTCAGATCATGG - Intronic
1200083479 X:153591245-153591267 AGCCCCGAGCTGGGAGGCAAAGG + Intronic
1202194262 Y:22280833-22280855 AGCCCAGATCTGAAAAGCAAAGG + Intergenic