ID: 1148674710

View in Genome Browser
Species Human (GRCh38)
Location 17:49438681-49438703
Sequence GCCTGTGGCCAGGCACGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 355}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148674710_1148674727 19 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674727 17:49438723-49438745 CCTGACGGCCCCCAAAGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 133
1148674710_1148674730 25 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674730 17:49438729-49438751 GGCCCCCAAAGAGCAGGGCTGGG 0: 1
1: 0
2: 2
3: 43
4: 399
1148674710_1148674720 4 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674720 17:49438708-49438730 AGCCCTAGACATCCCCCTGACGG 0: 1
1: 0
2: 0
3: 3
4: 81
1148674710_1148674729 24 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674729 17:49438728-49438750 CGGCCCCCAAAGAGCAGGGCTGG 0: 1
1: 0
2: 4
3: 18
4: 185
1148674710_1148674735 29 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674735 17:49438733-49438755 CCCAAAGAGCAGGGCTGGGGTGG 0: 1
1: 0
2: 3
3: 72
4: 518
1148674710_1148674731 26 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674731 17:49438730-49438752 GCCCCCAAAGAGCAGGGCTGGGG 0: 1
1: 0
2: 3
3: 43
4: 367
1148674710_1148674737 30 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674737 17:49438734-49438756 CCAAAGAGCAGGGCTGGGGTGGG 0: 1
1: 0
2: 17
3: 70
4: 609
1148674710_1148674728 20 Left 1148674710 17:49438681-49438703 CCCGCCCGTGCCTGGCCACAGGC 0: 1
1: 0
2: 5
3: 35
4: 355
Right 1148674728 17:49438724-49438746 CTGACGGCCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148674710 Original CRISPR GCCTGTGGCCAGGCACGGGC GGG (reversed) Intronic
900049984 1:588409-588431 GCCTGTGGAGAGGCTCGAGCGGG + Intergenic
900213560 1:1468872-1468894 GCCTGTGGCCAGACACACGGTGG + Exonic
900214915 1:1476216-1476238 GCCTGTGGTTAGGCACGAACTGG - Intronic
900221120 1:1509687-1509709 GCCTGTGGCCAGACACACGGTGG + Intergenic
900222126 1:1514570-1514592 GCCTGTGGTTAGGCACGAACTGG - Intronic
900291046 1:1923725-1923747 GCGTGGGGCCAGGGCCGGGCCGG + Intronic
900302096 1:1982928-1982950 GTCTGGGTCCAGGCAAGGGCAGG + Intronic
900500712 1:3003199-3003221 GTCTGTGACCAGGCCCAGGCAGG - Intergenic
900606037 1:3523943-3523965 GCCTGGGGCAAGGTGCGGGCAGG + Intronic
901027316 1:6285439-6285461 GCCTGGGGGCAGTCACGTGCTGG + Intronic
901230182 1:7637409-7637431 GCCTGTGCCTGGGCACGGCCAGG - Intronic
901230183 1:7637412-7637434 GGCCGTGCCCAGGCACAGGCAGG + Intronic
901491177 1:9597110-9597132 GCCGGGGGACAGGCACGTGCAGG + Intronic
904481807 1:30798638-30798660 GCCTGGGGCCAGGCAGGAACTGG - Intergenic
905390574 1:37633587-37633609 GCCTGTAGCCCGGCCCGGGGAGG - Intronic
905799676 1:40835112-40835134 GCCTGTTGGGAGGCAGGGGCAGG + Intronic
913957486 1:143318778-143318800 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
914051800 1:144144142-144144164 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
914127397 1:144822399-144822421 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
916211971 1:162366957-162366979 GGCTTTGGCAGGGCACGGGCGGG + Intronic
917470880 1:175324817-175324839 GCCTGTGTCCACGTACAGGCTGG - Intronic
920531553 1:206706278-206706300 GGCTGTGGCCAGGGAAAGGCAGG - Intronic
922465988 1:225845844-225845866 GCCAGCGGACAGGCACAGGCAGG + Exonic
922567549 1:226610829-226610851 GCCAGTGGCCAGTCACAGGAAGG + Intergenic
922705437 1:227788075-227788097 GGGTGTGGCCAGGCGGGGGCGGG + Intergenic
922800014 1:228360858-228360880 GCCCGTGGCCAGGGACAGGGAGG - Intronic
1064245031 10:13661423-13661445 ACATCTGGCCAGGCAGGGGCTGG + Intronic
1066760178 10:38741794-38741816 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1066961433 10:42230974-42230996 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
1067184145 10:44012877-44012899 GGCTGTGGCCAAGCAGAGGCTGG - Intergenic
1067227258 10:44384366-44384388 GCTCTTGGCCAGGCGCGGGCGGG - Intronic
1067427651 10:46221766-46221788 GCCTGTAGCCAGGCTCAGGCTGG + Intergenic
1067583073 10:47457679-47457701 GCCTGTAGCCAGGCTCAGGCTGG + Intergenic
1068730629 10:60353930-60353952 GCCTGTGACCAGGCACGAAATGG + Intronic
1069712284 10:70497364-70497386 CCTTGTGGCCAGGCATGCGCCGG - Intronic
1069830027 10:71277334-71277356 GCCTGAGGCCAGCAAGGGGCTGG + Intronic
1070782547 10:79146109-79146131 GCCTGAGGCCAGGGAAGGGTGGG + Intronic
1072436190 10:95416436-95416458 GCATGTGGCCTGCTACGGGCTGG - Intronic
1072682452 10:97516984-97517006 GCCTGTGACCAGGGAGAGGCAGG + Intronic
1072994275 10:100229494-100229516 GGCTGCGGCCGGGCGCGGGCGGG - Exonic
1074897367 10:117788923-117788945 GCCTGTGAGCAGGGAGGGGCAGG + Intergenic
1075425995 10:122342090-122342112 GCCTGTGGCCAGGCCTGAGCTGG - Intergenic
1076218812 10:128716796-128716818 GGCTTTGGCTTGGCACGGGCAGG - Intergenic
1076681712 10:132175562-132175584 GCCTGTGGCCACTCAGGGTCTGG + Intronic
1077044506 11:538403-538425 GCCTGGGGCCTTGCACTGGCTGG + Intronic
1077065998 11:641166-641188 TCCTCTGGCCAGGGACTGGCAGG - Intergenic
1077177886 11:1198801-1198823 GCCAGTGGGGAGGCAGGGGCGGG + Intronic
1077300503 11:1844387-1844409 GGCTGTGGCCAGGAAGGGGTTGG + Intergenic
1077446236 11:2592291-2592313 GCCTGTCGAGAGGCACAGGCAGG + Intronic
1078452182 11:11448751-11448773 GTCTGAGGTCAGGCAGGGGCCGG + Exonic
1078694788 11:13620395-13620417 GGCTGTGGCCAGGTACGTGCAGG + Intergenic
1081994975 11:47358533-47358555 GCGTGTGCACAGGTACGGGCAGG - Intronic
1083137386 11:60691994-60692016 GCCTGTGGCCAGGGAGGGTGGGG - Intergenic
1083630838 11:64094574-64094596 GCCTGCGGTTAGGCAGGGGCAGG - Intronic
1083638393 11:64132510-64132532 GGCAGTTGCCAGGGACGGGCGGG + Intronic
1083668582 11:64288319-64288341 GCCTGTGGGAAGGCAGGGGCTGG - Exonic
1083740845 11:64711141-64711163 GCCTGTGGACAGCCATGGGAGGG - Intronic
1084462290 11:69302656-69302678 GCCTGGGGCCAGGCTGGGGCTGG + Intronic
1084483717 11:69436232-69436254 GCCTGGGGCCACTGACGGGCAGG + Intergenic
1084504113 11:69554360-69554382 GGCTCTGGCCAGGCAGGAGCCGG - Intergenic
1084871460 11:72101358-72101380 CCAGGTGGCCAGTCACGGGCAGG - Intronic
1085475471 11:76786206-76786228 TCATGTGGCCAGGCTCGTGCAGG + Intronic
1089292321 11:117444843-117444865 GCCTCTTCCCTGGCACGGGCGGG + Intronic
1089583385 11:119495393-119495415 GCCAGTGGCCGGGCATGGCCTGG - Intergenic
1090258036 11:125299465-125299487 GACTGAGGCCAGGGAAGGGCGGG + Intronic
1091225252 11:133953272-133953294 GCCTGTGGCCCTGCATGTGCTGG - Intronic
1091657579 12:2356734-2356756 CCCTGCGTCCAGGCAGGGGCTGG + Intronic
1091730440 12:2876872-2876894 GCCTGTGCCCAGGCCAGGCCTGG + Intronic
1091792974 12:3282032-3282054 GCCTGTGGCCAGGCCCAGGCTGG + Intronic
1092429400 12:8396900-8396922 GCCCGTGGCCAGGCCCGCTCTGG + Intergenic
1096072018 12:48780682-48780704 CTCTCTGGCCAGGCATGGGCTGG - Intronic
1096241681 12:49963119-49963141 GCATGGGGCCAGGCACGGGCAGG + Intronic
1101945285 12:109131609-109131631 GCCAGTCACCAGGCAAGGGCAGG - Intronic
1102037831 12:109782383-109782405 CCCTGTGGACAGACACAGGCAGG + Intergenic
1102300314 12:111766767-111766789 GCCAGGGGGCAGCCACGGGCCGG + Intronic
1102506326 12:113386861-113386883 GGCTGTGGCCAGGGAGGGGAGGG - Intronic
1102958977 12:117079700-117079722 GCCTGAGGCCAGGGAGGGGAGGG + Intronic
1103076702 12:117989059-117989081 GATGGTGGCCAGGAACGGGCAGG + Intergenic
1103967929 12:124652109-124652131 GGGTGGGGGCAGGCACGGGCTGG - Intergenic
1106873486 13:34046828-34046850 GCCTGTGGCAAGGAAGGGGATGG + Intergenic
1106928803 13:34641236-34641258 GCCTGGGGTCAGGCACAGGAGGG + Intergenic
1110356753 13:74575888-74575910 GCCTGGGGCCGGGCCGGGGCGGG - Intergenic
1112092069 13:96091833-96091855 GCCTGTTGCCTAGCACGGCCTGG + Intronic
1112521394 13:100098495-100098517 GCCCTTGGCCAGGCAGGGTCGGG + Intronic
1113904195 13:113811674-113811696 CCCTGTGGTCCGGCACGGGGTGG + Intronic
1113973784 13:114211326-114211348 CCCTGTGGACAGGCTGGGGCTGG - Intergenic
1119473436 14:74913056-74913078 GGCTGTGGCCAGCCATGGTCGGG + Intronic
1119652398 14:76392962-76392984 GCCTGTGGCCAGCCCTGGGAGGG + Intronic
1119835777 14:77747757-77747779 GCGGCTGGCCAGGCAGGGGCTGG - Intronic
1122523576 14:102363527-102363549 GCCTGGGGCCAGGCGCCGGTGGG - Intronic
1122987388 14:105218807-105218829 GCCTGTGGCCAGCACGGGGCAGG + Intronic
1202930899 14_KI270725v1_random:31312-31334 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1124053932 15:26224472-26224494 GCCTGTGACCAGGAACTGCCAGG + Intergenic
1124098219 15:26669205-26669227 TCCTGTGGCAAGGAAAGGGCAGG - Intronic
1124220573 15:27846900-27846922 GGCTGAGGACAGGCAAGGGCAGG + Intronic
1125750026 15:42021654-42021676 TCCTGAGACCAGGCAGGGGCTGG - Intronic
1126739082 15:51759880-51759902 GCCTGAGGCCAGCCAGGGGCAGG + Intronic
1127960157 15:63884855-63884877 GCCTGAGGCCAGGAAAGGCCAGG + Intergenic
1129208023 15:74048604-74048626 GCCCGTTGCCAGGCACCGGGTGG - Intergenic
1129319010 15:74763440-74763462 GCCAGTGGGCCGGCAGGGGCTGG + Intergenic
1129746350 15:78024173-78024195 GCCTGTTGCCAGGGACCAGCTGG - Exonic
1131676155 15:94672776-94672798 GCCTGTGGCCAGGTCGGGGCAGG + Intergenic
1131999291 15:98163239-98163261 GCCCATGGGCAGCCACGGGCAGG + Intergenic
1132115387 15:99131934-99131956 GCCTCTGGACAGGCAGGGGCAGG - Exonic
1132648752 16:1010944-1010966 GCCTGTGGCAAGGCACTCACAGG - Intergenic
1132679333 16:1133324-1133346 GCCTGTGGCCTGGAAGGTGCAGG - Intergenic
1132716288 16:1291743-1291765 GCAGCTGGTCAGGCACGGGCAGG - Intergenic
1132886667 16:2185233-2185255 CCGTGGGGCCAGGCAGGGGCCGG - Intronic
1133224842 16:4336093-4336115 CCCTGTGGCCAGGCCCACGCTGG + Intronic
1134610820 16:15606635-15606657 GGCTGGGGGCAGGCATGGGCAGG - Intronic
1136394961 16:29987650-29987672 GCCGGGGCCCAGGGACGGGCAGG - Exonic
1136493234 16:30624637-30624659 GCCTGTGGCCAGACATGGCCTGG - Intergenic
1136722623 16:32337482-32337504 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
1136840946 16:33543475-33543497 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
1136927517 16:34388601-34388623 CCTCGTGGCCAGGGACGGGCGGG + Intergenic
1136977057 16:35023205-35023227 CCTCGTGGCCAGGGACGGGCGGG - Exonic
1138116171 16:54362400-54362422 TGCTGTGGCCAGGCTGGGGCTGG + Intergenic
1138451966 16:57098413-57098435 GCCTGTCGCCTGGCAGGAGCTGG + Intronic
1140127788 16:72132471-72132493 CCCTGTGGCCAGGAAGGGCCAGG + Intronic
1140207851 16:72948134-72948156 CCCTGTGGCGAAGCCCGGGCAGG + Intronic
1140563582 16:76012849-76012871 GCATGTGGCCAGGTCAGGGCCGG - Intergenic
1140947612 16:79784578-79784600 GCATGTGGCCAGGCAAGTGACGG + Intergenic
1141723528 16:85770686-85770708 GTGTGTGGCAAGGCACGTGCAGG + Intergenic
1141763870 16:86046142-86046164 GCCTGGGACCAGGCTCGAGCTGG + Intergenic
1142215113 16:88826207-88826229 GCGTGTGCCCAGGTACAGGCAGG + Intronic
1203003808 16_KI270728v1_random:180282-180304 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1203135416 16_KI270728v1_random:1716689-1716711 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1203151111 16_KI270728v1_random:1843772-1843794 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
1142708535 17:1710761-1710783 GGCGGCGGCCAGGCTCGGGCAGG - Intergenic
1142756393 17:2018869-2018891 GCATGTGGACAGTGACGGGCAGG + Intronic
1142812589 17:2402119-2402141 GCCGGTCGCCAGGCGCGGGGAGG - Intergenic
1142849614 17:2697993-2698015 GCTCCTCGCCAGGCACGGGCAGG + Exonic
1143033994 17:3984033-3984055 GCCTGGGACCAGGCACTGGGTGG - Intergenic
1143251167 17:5524171-5524193 TACTGTGGCCAGGCGCGGTCTGG - Intronic
1144547884 17:16215092-16215114 GGCTGTGGCCGGGCCGGGGCTGG - Intronic
1144577285 17:16437106-16437128 CTCTGTGCCCAGGCAAGGGCAGG - Intergenic
1145790759 17:27625184-27625206 GCCTTTGTCCAGGCAAGAGCAGG + Exonic
1145963581 17:28901615-28901637 TCCTGTGGAGAGGCAAGGGCTGG + Exonic
1147374962 17:40017839-40017861 GCCCCTGGCCAGGCACCAGCTGG - Intergenic
1147400296 17:40176971-40176993 GTCTGTGGGCAGGTACTGGCAGG - Intergenic
1147690277 17:42310558-42310580 GGATGTGGCCAGGCACGTGGAGG + Exonic
1147758270 17:42782142-42782164 GCCTGGGGCGCGGCACTGGCAGG - Intronic
1147903357 17:43805768-43805790 GCCTGTGGCTAGGAAGGGGCTGG + Intronic
1148674710 17:49438681-49438703 GCCTGTGGCCAGGCACGGGCGGG - Intronic
1148849970 17:50549892-50549914 GCCTTGGGCCAGGCAGAGGCTGG - Intronic
1148856464 17:50581604-50581626 GCATGGGGCCAGCCCCGGGCGGG - Intronic
1148911420 17:50944976-50944998 CCCTTTGGGCAGACACGGGCTGG - Intergenic
1149467330 17:56890497-56890519 GCCTGTGGCCAGGGATGAACAGG + Exonic
1149984659 17:61338162-61338184 CCCTGTGGCCAGTCTCTGGCGGG + Intronic
1150130138 17:62664698-62664720 GCCTGTGCCCAGGCACTGCATGG - Exonic
1150343602 17:64387694-64387716 GCCTGCAGCCAGGCCCAGGCGGG + Intronic
1150428760 17:65099172-65099194 GGCTGTGGCCAAGCTAGGGCTGG + Intergenic
1151561642 17:74873009-74873031 GCTTGTGGGCGGGCCCGGGCAGG - Exonic
1151829037 17:76538788-76538810 GCCTGAGGCCAGACAGGGCCTGG + Intronic
1151976720 17:77487638-77487660 GTCAGTGGCCAGGGGCGGGCTGG + Intronic
1152249987 17:79207529-79207551 CCCTGTGGCCAGGCTCGGGCTGG + Intronic
1152461918 17:80446075-80446097 TGCTGTGGCCAGGCAGGGACTGG - Intergenic
1152622477 17:81372250-81372272 GGCTGTGGCCACACACGGGCTGG + Intergenic
1155221624 18:23690211-23690233 GGCTGTGGTCAGGTTCGGGCTGG + Intronic
1156467320 18:37356024-37356046 CCCTGGGGCCAGGCCAGGGCTGG - Intronic
1158934743 18:62354348-62354370 GTCAGTGGCCAGGGAGGGGCAGG - Intronic
1160563180 18:79771646-79771668 GCAGGCGGCCAGGCATGGGCGGG - Intergenic
1160696786 19:488860-488882 GCGTGGGGCCCGGCACGGGGCGG - Intergenic
1160736073 19:662979-663001 GCCTGAGGCAAGGCCGGGGCCGG - Intronic
1161117125 19:2503918-2503940 GCCTGTGGCCAGTGAGGAGCCGG + Intergenic
1161566210 19:5004306-5004328 GCCTGTGGCAGGGCAAGAGCTGG - Intronic
1161592665 19:5135781-5135803 GGCTGTGGCCATGGAAGGGCTGG + Intronic
1162318152 19:9953807-9953829 GGCTGTGGTCAGGCGCGGGGCGG - Intergenic
1162502047 19:11059680-11059702 GGCTGGGGCCAGGGCCGGGCAGG + Intronic
1162513300 19:11132772-11132794 GCCTCTGGCCAGGCATGGCGAGG + Intronic
1163704529 19:18804498-18804520 GGCTGTGGCCCGGCTGGGGCTGG + Intergenic
1164078847 19:21845324-21845346 CCCTGTGGGCAGGCCCAGGCAGG + Intronic
1166198318 19:41220549-41220571 GCCGGTGGGCAGGCAAGGACAGG + Intronic
1166765986 19:45252174-45252196 GCCTGTGGGCAGCCCCTGGCAGG + Intronic
1166800880 19:45456197-45456219 GCCTGTGGGGAGGCCCTGGCGGG + Intronic
1202691195 1_KI270712v1_random:96566-96588 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
925007409 2:454696-454718 GCGGGAGGCCAGGCAAGGGCTGG + Intergenic
925318111 2:2940454-2940476 CCCTGTGTCCTGGCAGGGGCAGG - Intergenic
925635415 2:5937393-5937415 GACTGAGGCCAGGGACAGGCAGG + Intergenic
925764114 2:7214454-7214476 CCCTGTGGACTGGCACTGGCAGG - Intergenic
926192847 2:10741547-10741569 GACAGTGGCCGGGCACTGGCGGG + Intronic
927213226 2:20651190-20651212 GCCTGTGGCCAGAGGCGGGGCGG + Intergenic
927441084 2:23118424-23118446 GCCTGTGGTAGGGCAAGGGCAGG - Intergenic
927518447 2:23685599-23685621 CCCTGTGGGCAGGCTCTGGCTGG + Intronic
927658524 2:24972033-24972055 GCCTGCTGCCAGGCAGCGGCGGG - Exonic
927861525 2:26562854-26562876 GGAAGTGGGCAGGCACGGGCGGG + Intronic
928085336 2:28342767-28342789 GCCTGTGGGAAAGCAGGGGCCGG - Intergenic
928225511 2:29444871-29444893 GTATGTGGACAGGCATGGGCAGG - Intronic
932823957 2:74923594-74923616 GCTTGTGGCCAGGACCAGGCTGG - Intergenic
933955194 2:87357384-87357406 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
934239384 2:90253598-90253620 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
934273801 2:91563100-91563122 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
934461828 2:94216952-94216974 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
934755134 2:96819324-96819346 GCCTGGGGGCAGGCAAGGGCAGG - Intronic
936629393 2:114185345-114185367 GCCTATAGCCAGGCAGGGGCTGG + Intergenic
937247263 2:120501802-120501824 GCCTGGGGCCAGAGATGGGCAGG - Intergenic
937317901 2:120943676-120943698 GGCTGGGGCCAGACACAGGCAGG - Intronic
937887344 2:126908968-126908990 CGCTGTGGGCAGGCAGGGGCAGG + Intergenic
942459438 2:176159288-176159310 GCCTCTGGCCAGGCCCGGCCAGG + Intronic
946180140 2:217944002-217944024 GCCTGTGTCCAGGCAGGGAGCGG + Exonic
947474474 2:230430705-230430727 GCCTATGGCCATGCCCAGGCAGG - Intronic
947902043 2:233729149-233729171 TCCTGTGGCCAGCCACGGCAGGG - Exonic
948403882 2:237703301-237703323 GCATGGGGACAGGAACGGGCTGG - Intronic
948642303 2:239383433-239383455 ACATGTGGGCAGGCAGGGGCAGG + Intronic
948771017 2:240251293-240251315 GCCCGGGGTCAGTCACGGGCTGG + Intergenic
948941058 2:241196709-241196731 GCCTGCGGCAAGGCAAGGGTGGG - Intronic
1169155695 20:3327869-3327891 ACTTCTGGCCAGGCAAGGGCAGG + Intronic
1171382874 20:24746478-24746500 GGCTGGGGCGTGGCACGGGCTGG - Intergenic
1171433372 20:25101310-25101332 AACTGTGGCCAGGCAGGGTCTGG - Intergenic
1171454100 20:25257269-25257291 GCCTGTGGCCCGGCAGGCCCTGG + Intronic
1172099561 20:32476989-32477011 TGCTGTGGGCAGGCATGGGCGGG + Intronic
1172245443 20:33442833-33442855 GCCTGGGTGCAGGCACAGGCTGG - Intronic
1173246274 20:41340031-41340053 GCCTTGGGCAAGGCCCGGGCCGG - Intergenic
1173985720 20:47259924-47259946 CCCTGTGGCCAGGTTCAGGCAGG - Intronic
1174322494 20:49752976-49752998 GCCTGTGGCCAGGAAAGGCTGGG - Intergenic
1174369560 20:50077482-50077504 GCAAGAGGCCAGGCAGGGGCCGG + Intergenic
1175540151 20:59743275-59743297 GCCTGGTGACAGGCGCGGGCAGG + Intronic
1175823397 20:61923953-61923975 GAGTGTGGCCAGGATCGGGCCGG - Intronic
1176189910 20:63803605-63803627 GCCAGTGGGCAGGGAGGGGCGGG - Intronic
1176235705 20:64052545-64052567 GTCTGTGCCCAGGCAGTGGCTGG - Intronic
1176592918 21:8659934-8659956 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1178690227 21:34744287-34744309 GCCTATGGCCAGGGAAGCGCAGG - Intergenic
1179727395 21:43348164-43348186 GCTTGTGGTCAGACATGGGCAGG + Intergenic
1179924444 21:44526611-44526633 CCCTGTGTCCAGGCAGGGCCTGG + Intronic
1180001340 21:44996853-44996875 GCCTGTGTCCAGTCCTGGGCAGG - Intergenic
1180275771 22:10637077-10637099 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1180550250 22:16532006-16532028 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1180626759 22:17198936-17198958 GCCTGCGACCAGGCAGGGGGAGG + Intronic
1180836111 22:18930350-18930372 GGCTGAGGCCAGGCAAGGGTCGG - Intronic
1180945131 22:19688525-19688547 GTGTGTGGGCAGGCACGGCCGGG - Intergenic
1180984035 22:19893585-19893607 ACCTGTGCCCAGGCCTGGGCCGG - Intronic
1181000544 22:19986064-19986086 GCCTGGGGCCACGCCCTGGCAGG - Intronic
1181000757 22:19986902-19986924 GGCTGGGGCCAGGGCCGGGCGGG - Intronic
1181051411 22:20239943-20239965 GCCAGTGCCCAGGCACAGCCTGG + Intergenic
1181276294 22:21689132-21689154 GCCTGTGGCCAGGCAGTGCTGGG + Intronic
1181354421 22:22289802-22289824 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
1182028411 22:27138209-27138231 CCATCTGGCCAGGCAGGGGCGGG + Intergenic
1182146825 22:28001740-28001762 GCTTGTGGACTGGCAAGGGCTGG + Intronic
1182272827 22:29166341-29166363 GCCTGTGGTCATGCACCTGCTGG + Intronic
1182296022 22:29311599-29311621 GCCTGTGGTCAGCCGCCGGCTGG - Intronic
1182440951 22:30363535-30363557 GCCTGAGGCCAGGAAGGGGCAGG + Intronic
1182557433 22:31136852-31136874 GCCTGCTGCCAGGCATGGGAAGG - Intronic
1183019867 22:35018433-35018455 GCCTGTGGCCTGGCACAGGGAGG + Intergenic
1183712292 22:39512257-39512279 GCCAGTGGCCAGGAAGGGCCAGG + Exonic
1184283148 22:43450281-43450303 GCATGTGGCCAGGCAGGACCGGG - Intronic
1184531336 22:45057657-45057679 GGCTATGGCCAGGCACACGCAGG - Intergenic
1184667089 22:45994915-45994937 GCCAGAGGCCAGGGACTGGCTGG - Intergenic
1185070086 22:48651385-48651407 GGCTGTGCCCAGGAAGGGGCAGG + Intronic
1185246333 22:49775209-49775231 GCCAGAGGCCAGGCCCGGGCAGG + Intronic
1185274424 22:49944203-49944225 GCTTGTGGCCAGCCATGGCCTGG - Intergenic
1203286203 22_KI270734v1_random:155649-155671 GGCTGAGGCCAGGCAAGGGTCGG - Intergenic
950187891 3:10956618-10956640 GGGGGTGGCCAGGCCCGGGCAGG - Intergenic
950476475 3:13218227-13218249 GCCTGGGGCAAGGCATGGGTGGG + Intergenic
953058470 3:39406913-39406935 GCACGTGGCCAGGCTCGGGCTGG + Intronic
953392223 3:42540364-42540386 GCCTGTGGCCAGTCAGAGGCTGG - Intergenic
954197681 3:49006194-49006216 GCCTATGGCCAGGCCTGGGGGGG + Intronic
954609793 3:51938203-51938225 GGCTGTGGGCAGGAAGGGGCTGG + Exonic
954677958 3:52325994-52326016 GCCTGTGGCTGGGCAGTGGCTGG - Intronic
955342522 3:58136148-58136170 ACCCGTGGCCAGGCACTTGCTGG - Exonic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
957073019 3:75580459-75580481 GCCCGTGGCCAGGCCCGCTCCGG + Intergenic
957427027 3:80051803-80051825 GTCCGTGGGCAGCCACGGGCGGG - Intergenic
959969340 3:112391544-112391566 GCCTGTGGCCAGGCAGGAGAAGG - Intergenic
961281064 3:125766318-125766340 GCCTGTGGCCAGGCCCGCTCTGG - Intergenic
961318659 3:126057464-126057486 GCCTGAGGGCAGGCTGGGGCAGG + Intronic
961831777 3:129626834-129626856 GCCTGGGGCCTGGCCTGGGCGGG - Intergenic
962221292 3:133566523-133566545 GCCTGAGGCCAGGAAGGGGTTGG + Intergenic
962526703 3:136243755-136243777 AACTGTGGCCGGGCACGGCCTGG + Intergenic
962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG + Intronic
968148355 3:196318298-196318320 GCCGGTGCGCAGGCGCGGGCAGG - Intronic
968233289 3:197016614-197016636 GGCTGTGGCCAGGCATGGGACGG + Intronic
968556136 4:1247438-1247460 GGAGGTGGCCAGGCCCGGGCAGG + Intronic
968622161 4:1608691-1608713 GGCTGAGGCCAGGCACTGGTGGG - Intergenic
968701216 4:2059114-2059136 GCGAGGGGCCCGGCACGGGCGGG - Intergenic
968748347 4:2372645-2372667 GCCTGCGGCTGGGCACGGGTGGG + Intronic
968935252 4:3606952-3606974 GCCTGGGGCCAGGCTCAGGGAGG + Intergenic
969016623 4:4107756-4107778 GCCCGTGGCCAGGCCCGCTCTGG + Intergenic
969296258 4:6271939-6271961 GCTTGTGGCCAGGAACACGCAGG - Intronic
969516917 4:7653042-7653064 GCCTGGGCCCAGGAAGGGGCAGG - Intronic
969796538 4:9532147-9532169 GCCCGTGGCCAGGCCCGCTCCGG - Intergenic
970454092 4:16204682-16204704 GACTGCGGCCATGCACAGGCAGG - Intronic
980969508 4:139555954-139555976 GCCGGTTGCCCGGCTCGGGCGGG - Intronic
985085139 4:186305615-186305637 GCATGGGGCCAGGCTGGGGCGGG - Intergenic
985495675 5:203688-203710 GTGTGTGGCCAGGCAGGAGCGGG - Exonic
985638933 5:1054155-1054177 GCCCTTGGCCAGACAGGGGCAGG - Intronic
985768869 5:1796594-1796616 GCCTGAGGCTGGGCACGGGCAGG - Intergenic
986362543 5:6994365-6994387 GGCTGTGGGCAGGGAGGGGCAGG - Intergenic
987302189 5:16606787-16606809 GCCTGGGGCGAGGCACCAGCTGG - Intronic
989638138 5:43557254-43557276 GCCCGCAGCCAGGCTCGGGCAGG + Intronic
997613077 5:135228770-135228792 GCTTGGGGCCAGGCAGGGGTGGG + Intronic
999247201 5:150161513-150161535 TCAAGTGGCCAGGCACAGGCTGG - Intergenic
1000048923 5:157545364-157545386 TCATTTGGCCAGGCAAGGGCAGG - Intronic
1000643236 5:163730538-163730560 TCCTGTGACCTGGCACAGGCTGG + Intergenic
1001315015 5:170635880-170635902 GCCAGTGCCCAGACACAGGCCGG + Intronic
1002000674 5:176194847-176194869 GGCGGGGGCCAGGCAGGGGCAGG + Intergenic
1002253665 5:177944134-177944156 GGCGGGGGCCAGGCAGGGGCAGG - Intergenic
1002427889 5:179186549-179186571 GCCTCTGGCCAGGGCTGGGCAGG - Intronic
1002704210 5:181149192-181149214 TCATGTGGCCAGGCGGGGGCTGG + Intergenic
1002843334 6:924422-924444 GCATGCCGACAGGCACGGGCAGG + Intergenic
1003058162 6:2841589-2841611 GCCTGTACCCAGGCGGGGGCGGG + Intronic
1005993445 6:30917703-30917725 GTGTGTGGCCAGGCAGGGGCCGG - Exonic
1006152934 6:31998929-31998951 CCTTGGGGCCAGGCAGGGGCTGG + Intronic
1006159242 6:32031666-32031688 CCTTGGGGCCAGGCAGGGGCTGG + Intronic
1006480912 6:34293388-34293410 ACCTGTGGCATGGCAAGGGCTGG + Intronic
1011470345 6:87701871-87701893 GGCAGTGGCCAGGGACGGCCCGG + Exonic
1011555157 6:88565972-88565994 GCATGTGGCAAGCCACGAGCTGG - Intergenic
1019254689 7:41737-41759 GCCTGTGCCCAAGCATGAGCAGG - Intergenic
1019600783 7:1882707-1882729 GCCTGTGGCAGGGCAGTGGCTGG - Intronic
1019646028 7:2129377-2129399 GAATGTGGACAGGCACGAGCAGG + Intronic
1019771159 7:2884303-2884325 GCCAGTGAGCAGGCACAGGCCGG + Intergenic
1019918468 7:4148408-4148430 GCCTGGGGCCAGGCCCGGCCTGG - Intronic
1020002521 7:4764012-4764034 GCCTCTGCCCAGGCCCTGGCGGG + Exonic
1022700395 7:32754125-32754147 GCGGCTGGCCAGGCAGGGGCTGG - Intergenic
1023868961 7:44252514-44252536 GCCTGTGATGGGGCACGGGCAGG + Intronic
1023939225 7:44759424-44759446 CCGTGGGGCCAGGCACGGACAGG - Exonic
1023985062 7:45089259-45089281 GCCCGTGGCCAGGAAGAGGCGGG + Intergenic
1025279466 7:57616333-57616355 GGCTGTGGCCAGGCAGGGAAAGG - Intergenic
1025305265 7:57849167-57849189 GGCTGTGGCCAGGCAGGGAAAGG + Intergenic
1026045269 7:66902456-66902478 GCCTGTTGCGAGGCAGGAGCTGG - Intergenic
1026392151 7:69912400-69912422 GGCTGGGGCCAGGAACAGGCAGG - Intronic
1026890074 7:73976789-73976811 GCCTGAGGCCACGGAGGGGCTGG + Intergenic
1027470136 7:78563377-78563399 CACTGTAGCCAGGCACGGGAAGG - Intronic
1029075098 7:97928556-97928578 GCCCGTGGCCAGGCCCGCTCTGG + Intergenic
1029157264 7:98526120-98526142 GCCTGAGCACAGGCATGGGCTGG + Intergenic
1030081505 7:105782594-105782616 GACTGTGGCCAGCCCTGGGCGGG + Intronic
1035111701 7:156488112-156488134 GGCTGTGTTCAGGCAGGGGCCGG - Intergenic
1035611085 8:964865-964887 GCCTGTGGCCATGCTCCGGGGGG + Intergenic
1036242433 8:7091822-7091844 GCCCGTGGCCAGGCCCGCTCTGG - Intergenic
1036359123 8:8065319-8065341 GCCTGTGGCCAGACCCGCTCTGG - Intergenic
1036830305 8:12015309-12015331 GCCTGTGGCCAGGCCCGCTCTGG + Intronic
1036891835 8:12601633-12601655 GCCTGTGGCCAGACCCGCTCTGG + Intergenic
1036899384 8:12659608-12659630 GCCCGTGGCCAGGCCCGCTCTGG + Intergenic
1036900451 8:12665755-12665777 GCCCGTGGCCAGGCCCGCTCTGG + Intergenic
1038123450 8:24643943-24643965 GCCTGTATCCAGGCAGAGGCTGG + Intergenic
1038885901 8:31662963-31662985 GCCTGTGGCCAAGCCCTGCCTGG + Intronic
1039790093 8:40868767-40868789 GGCAGTGGAGAGGCACGGGCAGG - Intronic
1039832146 8:41223827-41223849 GCCTGAGGCGGGGCACGGCCAGG + Intergenic
1043889994 8:85644084-85644106 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043891534 8:85655998-85656020 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043892606 8:85662835-85662857 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043892951 8:85714500-85714522 ACCTGTGACCAAGCAAGGGCTGG - Intergenic
1043895638 8:85735954-85735976 ACCTGTGACCAAGCAAGGGCTGG - Intergenic
1043897041 8:85745854-85745876 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043899366 8:85764221-85764243 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043900975 8:85776415-85776437 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043902939 8:85791690-85791712 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043904549 8:85803883-85803905 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043906161 8:85816074-85816096 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1043907769 8:85828264-85828286 ACCTGTGACCAAGCAAGGGCTGG + Intergenic
1045311838 8:101009821-101009843 ACCTGGGGCCAGGAAGGGGCAGG + Intergenic
1046690899 8:117283040-117283062 GCCTGGGGCCAAGCAAGGCCTGG + Intergenic
1048332850 8:133482818-133482840 TCCAGTGACCAGGCATGGGCCGG - Intronic
1049161281 8:141099533-141099555 ACGTGTGGGCAGGCACGGGGAGG + Intergenic
1049208900 8:141376328-141376350 GCCTGGGGCCCTGCACGGGCAGG - Intergenic
1049429744 8:142555236-142555258 ACGTGTGGGCAGGCACGGGGAGG - Intergenic
1049431023 8:142564964-142564986 GCATGGGGCCAGCCACGGGAAGG + Intergenic
1049612726 8:143562904-143562926 GCCTGTGCCCGGGCATGGCCTGG + Exonic
1049646681 8:143738805-143738827 GTCTGTGGCCAGGGAGGGTCTGG - Intergenic
1049743658 8:144253451-144253473 ACCTGTGCCCAGGGAAGGGCTGG - Intronic
1051187047 9:14471315-14471337 CCCTGAGGTCAGGCACCGGCTGG + Intergenic
1053379420 9:37636463-37636485 ACCTGTGGCCAGGCAGGGCGGGG - Intronic
1054272499 9:63044881-63044903 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
1054303559 9:63393570-63393592 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1054402337 9:64720080-64720102 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1054435940 9:65204395-65204417 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1054454932 9:65424950-65424972 GCCTGGGGCCAGGCTCAGGGAGG - Intergenic
1054494452 9:65817292-65817314 GCCTGGGGTCAGGCCAGGGCAGG + Intergenic
1055444937 9:76373252-76373274 GCTTTTGGCAAGGCACTGGCTGG - Intergenic
1056821519 9:89845492-89845514 GCCTATGGCCAGGCAAGGCCAGG + Intergenic
1057403147 9:94742347-94742369 GCCTGTGGGTAGGCACTGGTTGG - Intronic
1057921992 9:99105168-99105190 GCCTGTGGCCCGGCCCGGCCCGG - Exonic
1058864057 9:109145266-109145288 GACTGTGGCCAGGCACAGGCGGG - Intronic
1059308334 9:113371930-113371952 GGCTGTGCCCAGGCAAAGGCAGG - Intergenic
1059670066 9:116483053-116483075 GCCTTTGGCCAGGCAAGGGCAGG + Intronic
1060161534 9:121369685-121369707 CCCTGGGGCCAGGCCAGGGCTGG + Intronic
1060477469 9:123997304-123997326 TCCTGGGGCCAGGCAGGTGCTGG - Intergenic
1060530998 9:124346930-124346952 GCCTGTGGCGAGGCTTGGGCTGG - Intronic
1061774422 9:132951332-132951354 TGCTGTGCCCAGTCACGGGCTGG - Intronic
1061840508 9:133356319-133356341 GCCTGCGGACACGGACGGGCGGG + Exonic
1062350281 9:136135362-136135384 GATTCTGGCCAGGCAGGGGCAGG + Intergenic
1062413501 9:136436438-136436460 TCCTGTGTCTAGACACGGGCAGG + Intronic
1062457629 9:136646929-136646951 GCCTGTGGCTAGGCCTGTGCAGG - Intergenic
1203791010 EBV:151532-151554 GGCCGTGGCCAGGTACGGGCTGG - Intergenic
1203622965 Un_KI270749v1:138741-138763 GCCTGGGGTCAGGCCAGGGCAGG - Intergenic
1187500744 X:19836475-19836497 GTCCGTGGTCAGGCACAGGCAGG + Intronic
1189298573 X:39936086-39936108 GCCGGTGGCCCAGCACTGGCAGG + Intergenic
1190262566 X:48806619-48806641 GCCTGAGGCCAGGCAGGCACAGG - Exonic
1192177516 X:68895187-68895209 GCCTGTGGCCAGGCGGGTGCAGG + Intergenic
1192245109 X:69365541-69365563 GACTGTGGCCAGGCACTTCCTGG + Intergenic
1196196142 X:112840513-112840535 GCCAGCGGCCAGGGATGGGCAGG + Intronic
1198506248 X:137303927-137303949 GCCTGAGGCCAGGCGAGGGTAGG + Intergenic
1199979658 X:152914000-152914022 GCCTGTGGAGAGGGACGGGCTGG - Intergenic
1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG + Intronic
1200249211 X:154543312-154543334 GCCTGTGGCCAGCTTCGGGTTGG - Intronic
1201190909 Y:11441121-11441143 GCCTGGGGTCAGGCAAGGGCAGG - Intergenic
1201920051 Y:19224186-19224208 GCCTGGGGACTGGCATGGGCAGG + Intergenic