ID: 1148677824

View in Genome Browser
Species Human (GRCh38)
Location 17:49455362-49455384
Sequence GTTGGATTTCCAACAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148677824 Original CRISPR GTTGGATTTCCAACAACATC TGG (reversed) Intronic
901150213 1:7096312-7096334 GTTTGATGTCCACCACCATCAGG - Intronic
904415217 1:30356964-30356986 GTTGGTTGTCCAACCACAACAGG + Intergenic
904963803 1:34356094-34356116 GGTGGATATCCAACAAAATAGGG + Intergenic
911901229 1:103508327-103508349 GTTGGAGTTCCAACACCCTTTGG - Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
916275932 1:162993157-162993179 GTTGTATTTTCCACAGCATCTGG - Intergenic
919094782 1:193019601-193019623 GTTGGTGTTCCACTAACATCAGG + Intronic
919349632 1:196432579-196432601 GTTGGATTTCCAACTTAATTGGG + Intronic
924106592 1:240655007-240655029 GCTGGATTTTCATCAGCATCAGG + Intergenic
1063547754 10:6998807-6998829 GTTGGATTCCCAAGAGCATTGGG - Intergenic
1064612317 10:17116174-17116196 CTTGAATTTCCAACAAAATGTGG + Intronic
1066547416 10:36515555-36515577 ATTGAATTCCTAACAACATCTGG - Intergenic
1072049059 10:91685575-91685597 ATCAGATTTCCAACAACATATGG + Intergenic
1072762565 10:98069004-98069026 GTTAGATTTCAAACAAGCTCAGG + Intergenic
1091393687 12:141014-141036 ACTGGATTTCCAAGAACCTCTGG + Intronic
1097475093 12:60044284-60044306 ATTGTCTTTCCAACAACATTAGG + Intergenic
1104739418 12:131162101-131162123 GTTGCATTTCCCAGAGCATCTGG + Intergenic
1106904889 13:34395462-34395484 GTTGGCTTTCCCACAAAGTCCGG + Intergenic
1108166416 13:47698007-47698029 TTTGAATTTCCAACAGAATCAGG + Intergenic
1108935529 13:55876493-55876515 GTTGCTTTTCCAACAACTTGAGG + Intergenic
1109104219 13:58229352-58229374 GTTGGTTTCATAACAACATCTGG - Intergenic
1110275674 13:73639627-73639649 GTTGAACTTCCCAAAACATCTGG + Intergenic
1110368539 13:74715329-74715351 GTTGGAATGCCCACAACATTTGG + Intergenic
1111101219 13:83589542-83589564 GTTGTATTTTCAATAACAACAGG + Intergenic
1112609759 13:100945012-100945034 GTAGGATTTCCAAGAGCAGCCGG + Intergenic
1113047188 13:106168572-106168594 GTTTGATTGCCAAGAAGATCTGG - Intergenic
1126614268 15:50560597-50560619 GTTGAATATTCAACAATATCTGG + Exonic
1129893347 15:79086593-79086615 CTGGGACCTCCAACAACATCAGG + Intronic
1133717987 16:8467626-8467648 GTTGCATTTCCACCAAGCTCTGG - Intergenic
1137933276 16:52608756-52608778 GTTGGCTTTCCAACCAGATCTGG - Intergenic
1141356351 16:83350173-83350195 CTCGGCCTTCCAACAACATCAGG + Intronic
1148677824 17:49455362-49455384 GTTGGATTTCCAACAACATCTGG - Intronic
1148980005 17:51564684-51564706 GTTGGCTTTCCAAAGATATCTGG - Intergenic
1150356264 17:64487886-64487908 ATTGGATATCCAACAATGTCAGG + Intronic
1152048638 17:77955976-77955998 GGAGGATTTCCATCAACAACTGG + Intergenic
1154382408 18:13864343-13864365 GTTGGATTTCCCACAGGATGTGG + Intergenic
1155449841 18:25951972-25951994 GTGGGCTTCCCAACAACAGCAGG + Intergenic
1157453613 18:47806754-47806776 GTTGTATATTCAACAACTTCTGG + Intergenic
1159361324 18:67407432-67407454 GTTGGTTTTCCTCGAACATCAGG - Intergenic
1167532879 19:50029507-50029529 GTTGAATTTCAAAGCACATCTGG + Intronic
925937010 2:8773840-8773862 GGTGGAATTCCAGCAACAGCTGG - Intronic
927587638 2:24322450-24322472 CATTGATTTCCAACAACATGTGG + Intronic
928468697 2:31551123-31551145 GTTAGATTTACAACAAAATATGG - Intronic
930297531 2:49573583-49573605 CTTGGATTTCAATAAACATCCGG + Intergenic
935782904 2:106523606-106523628 GTTGGTGTTACAAGAACATCAGG + Intergenic
937666883 2:124498112-124498134 ATTGGATTTCCATCAGCATATGG + Intronic
942049587 2:172126850-172126872 GGTGGATTTCCAGCAAGTTCTGG - Intergenic
944728410 2:202495562-202495584 GTTGCATTTCCAAGACCACCCGG - Intronic
945163353 2:206916265-206916287 GTTGGATTTTCAATATCATTTGG + Intergenic
945499400 2:210551794-210551816 ATTGGATTTCCAAGGATATCTGG + Intronic
1176710025 21:10142851-10142873 GGTGAATTTTCAACAACATTTGG - Intergenic
1177776991 21:25578853-25578875 GTTGAATTTCCAACATCAGTGGG - Intergenic
1178512026 21:33213426-33213448 GTTGAATTTCCTACATCATCTGG + Intergenic
1178671734 21:34596692-34596714 GTTGGTGTTCCAACATCATCAGG - Intronic
1180632826 22:17241640-17241662 GTGGGAATTCCAACAACGTCTGG - Intergenic
1183195333 22:36349892-36349914 GGAGGATTTCCAACAAAAACAGG + Intronic
1183775256 22:39959906-39959928 GTTTGATTTCAAACAGCACCTGG + Intronic
1183835310 22:40447923-40447945 GTTGGAATTACAACCACACCGGG - Intronic
1184207008 22:43011506-43011528 GTTTGATATTCCACAACATCCGG + Intronic
960132123 3:114068381-114068403 GTTGGATTTTTAACAACTTCAGG + Intronic
960340636 3:116470788-116470810 GCTGACTTTCCAACATCATCAGG + Intronic
960452940 3:117832451-117832473 GTTGGATTTCCAAGTGCAGCTGG - Intergenic
961591880 3:127987345-127987367 GTTGAATTTCTAACGATATCTGG - Exonic
965901402 3:173645336-173645358 GCTGGATTCCCACCAACATTGGG + Intronic
969237918 4:5879354-5879376 CTTGGAGTTCCCACAACATGAGG + Intronic
974354112 4:60789983-60790005 GTTGGATTTCTACCATCAGCTGG - Intergenic
974732809 4:65891210-65891232 GTTGCATGTCTAACTACATCAGG - Intergenic
978988049 4:115040560-115040582 CTTGGACTTCCAACAAAAACAGG - Intronic
979807183 4:124988642-124988664 GTTGCATATCTTACAACATCTGG + Intergenic
983304591 4:165970297-165970319 CTTTGATTTCTAACAAAATCAGG + Intronic
984159050 4:176229262-176229284 TTTACATTCCCAACAACATCTGG - Intronic
988560081 5:32272984-32273006 GTTGGGTTTCCACTAACATATGG + Intronic
1003619851 6:7690182-7690204 GTTGGAATTCTAACAACAAAAGG - Intergenic
1012056994 6:94426093-94426115 TATGGATGTTCAACAACATCTGG + Intergenic
1016647830 6:146430262-146430284 GTTGCAGTTCCAGCAACAACAGG - Intronic
1018319314 6:162589880-162589902 TTTGTATCTCCAACAGCATCTGG + Intronic
1021066126 7:16175002-16175024 GTTGGTTTTTGAGCAACATCTGG + Intronic
1022858553 7:34341405-34341427 GTTGTATTTCAAACAGCCTCAGG + Intergenic
1028628571 7:92906159-92906181 GATGGATTTCTCACAAGATCTGG + Intergenic
1034946867 7:155267844-155267866 GTTGGATGTCAAACAAAATCAGG - Intergenic
1043044775 8:75308416-75308438 GGTGGACTTCAAACAATATCTGG + Intergenic
1047894686 8:129353487-129353509 GTTGAATTTCCATCACCAGCGGG - Intergenic
1053758720 9:41335294-41335316 GGTGAATTTTCAACAACATTTGG + Intergenic
1055286998 9:74739440-74739462 GTTGAATTTCCTACAAAATAGGG + Exonic
1058843779 9:108935263-108935285 GTCGGACTTGCACCAACATCAGG + Intronic
1202794786 9_KI270719v1_random:111846-111868 GGTGAATTTTCAACAACATTTGG - Intergenic
1189830196 X:44964866-44964888 GTAGGACTTTCATCAACATCTGG - Intronic
1192175431 X:68881989-68882011 GTGGGACTTCCAAGTACATCTGG + Intergenic
1202343711 Y:23897513-23897535 GATGGTTTTCCAAAGACATCTGG - Intergenic
1202527057 Y:25772572-25772594 GATGGTTTTCCAAAGACATCTGG + Intergenic