ID: 1148678057

View in Genome Browser
Species Human (GRCh38)
Location 17:49456533-49456555
Sequence CAGCGTGACCAGAGTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148678057_1148678065 22 Left 1148678057 17:49456533-49456555 CCCCCTCCACTCTGGTCACGCTG 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1148678065 17:49456578-49456600 CTGCTTCTCAGCTATTACCCTGG 0: 1
1: 0
2: 1
3: 20
4: 171
1148678057_1148678066 23 Left 1148678057 17:49456533-49456555 CCCCCTCCACTCTGGTCACGCTG 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1148678066 17:49456579-49456601 TGCTTCTCAGCTATTACCCTGGG 0: 1
1: 0
2: 0
3: 20
4: 155
1148678057_1148678067 29 Left 1148678057 17:49456533-49456555 CCCCCTCCACTCTGGTCACGCTG 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1148678067 17:49456585-49456607 TCAGCTATTACCCTGGGATGTGG 0: 1
1: 0
2: 0
3: 20
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148678057 Original CRISPR CAGCGTGACCAGAGTGGAGG GGG (reversed) Intronic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
911203884 1:95073598-95073620 CAGTGTGACCAGAGTAGTTGAGG + Intergenic
911642448 1:100303556-100303578 CAGGTTGACCACAGTGGAGGAGG + Intergenic
914988793 1:152480817-152480839 CAGAGCAAGCAGAGTGGAGGTGG - Intergenic
915936338 1:160092249-160092271 CAGAGTGAGGAGGGTGGAGGGGG + Intronic
917978701 1:180256226-180256248 CAACGTGACCAGATGGGCGGAGG - Intronic
919442151 1:197649175-197649197 CAATGTGACCAGAATAGAGGAGG + Intronic
921080196 1:211732962-211732984 CAAAGTGACCAGACTGGAAGTGG - Intergenic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923521909 1:234741437-234741459 CAGAGTGACAACAGTGGAGCTGG + Intergenic
1063615492 10:7596594-7596616 CAGCGTGATCATTGTGCAGGAGG - Intronic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067686385 10:48468386-48468408 AAGTTTGACCACAGTGGAGGCGG + Intronic
1068461676 10:57337185-57337207 GAGCGTGGCCAGAGCAGAGGTGG + Intergenic
1073122557 10:101131562-101131584 CTGCGTGACCCGGGTGGAGGTGG - Exonic
1073216715 10:101840553-101840575 CAGCGGGACCGAAGTGGGGGGGG - Intronic
1074707042 10:116142288-116142310 AAACATGACCAGAGTGGAAGTGG - Intronic
1076677759 10:132156279-132156301 CAGCATGAGCAGGATGGAGGAGG - Intronic
1076697242 10:132252873-132252895 CAGAGTGACCTGGGAGGAGGCGG - Intronic
1077353952 11:2106109-2106131 CTGAGTGACCAGAGTGCAAGAGG - Intergenic
1077405302 11:2379898-2379920 CTGCGACACCAGGGTGGAGGGGG - Intronic
1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1081876912 11:46414686-46414708 CAGCTTGGGCAGAGTGCAGGTGG + Intronic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1084459159 11:69286643-69286665 CAGCGTGACGAGAGTGGGGATGG + Intergenic
1084605189 11:70168185-70168207 CAGCATGTGCAGAGTGCAGGAGG - Intronic
1088686679 11:112289988-112290010 CAGCGCACCCAGACTGGAGGTGG - Intergenic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1093027224 12:14255953-14255975 AAGCTTGACCAGAGGGTAGGAGG + Intergenic
1094410545 12:30163986-30164008 CACAGTGACCAGAGATGAGGTGG + Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1101303477 12:103504420-103504442 CATCGTGGACAGCGTGGAGGTGG + Intergenic
1103004009 12:117407508-117407530 GAGCGTGAGCCAAGTGGAGGAGG - Intronic
1103004044 12:117407671-117407693 GAGCGTGAGCCAAGTGGAGGAGG - Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1104986474 12:132600432-132600454 CAGCGTGACGGGACTGGAGTGGG - Intergenic
1105901999 13:24763649-24763671 CAGCGTGCCAAGAGTGGTTGGGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1110968238 13:81728551-81728573 CAGCGAGAAAAGAGAGGAGGAGG + Intergenic
1113124125 13:106957709-106957731 GAGACTGAACAGAGTGGAGGAGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114302856 14:21393856-21393878 CAGCGTGACAAGGATGGAGCTGG + Exonic
1114664312 14:24369065-24369087 AACCGTGGCCAGAGGGGAGGGGG - Intronic
1114715016 14:24815879-24815901 CAGGCTCACCAGAGTGGAGGTGG + Intronic
1115960848 14:38835454-38835476 GAGCGTGCCCAGAGAGGAGAAGG + Intergenic
1117735045 14:58760371-58760393 CAGCCTGAATAGAATGGAGGAGG - Intergenic
1118974137 14:70663036-70663058 TCAGGTGACCAGAGTGGAGGCGG - Intronic
1121115804 14:91341813-91341835 GAGCGTCAGCGGAGTGGAGGAGG - Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121783998 14:96640862-96640884 CAGATTGACAAGGGTGGAGGTGG + Intergenic
1123056293 14:105572205-105572227 GAACGTGACCAGTGTGGGGGAGG - Intergenic
1123057640 14:105579602-105579624 GAACGTGACCAGTGTGGGGGAGG + Intergenic
1123080722 14:105692333-105692355 GAACGTGACCAGTGTGGGGGAGG - Intergenic
1123081919 14:105699535-105699557 GAACGTGACCAGTGTGGGGGAGG + Intergenic
1124989754 15:34660055-34660077 CAGAGTCACCAAAGTGGAGGAGG - Intergenic
1127613792 15:60663061-60663083 CAGGGAGATCAGAGTGGGGGTGG - Intronic
1128680893 15:69650577-69650599 CAGAGTGACAACAGAGGAGGGGG - Intergenic
1128776629 15:70325250-70325272 CAGCCTGACTGGAGAGGAGGTGG - Intergenic
1129361915 15:75029623-75029645 CAGCCAGGCCAGAGTGGGGGAGG + Intronic
1129414026 15:75364800-75364822 CAGTGTGACAAGAGTGCATGTGG + Intronic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1133302513 16:4791316-4791338 CAGCGTGACTATGGTGGAAGAGG + Intronic
1134650509 16:15904784-15904806 CAGAGTGACCAAAGAGCAGGTGG - Intergenic
1134690112 16:16185462-16185484 CAGCCTTCCCAGAGTGAAGGGGG + Intronic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138573409 16:57890831-57890853 CAGCTTGACCAGAGAGGCAGGGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1142598999 17:1043964-1043986 CAGCGTCCCCAGACTGGAGAAGG - Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143783005 17:9239318-9239340 CAGCTTGCCCAGAGTGCTGGGGG + Intronic
1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG + Intergenic
1144573385 17:16414881-16414903 CAGGGAGACCAGTTTGGAGGTGG + Intergenic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1146429076 17:32773585-32773607 AAGGTTGACCATAGTGGAGGAGG - Intronic
1146648860 17:34593896-34593918 CAGCGTGACCGGAGACGAGCAGG - Intronic
1147758083 17:42781277-42781299 CACCGACACCACAGTGGAGGTGG + Exonic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1152488144 17:80609110-80609132 CAGCGCGACCCGTGTGGAGAGGG + Intronic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154345564 18:13540973-13540995 CAGCGGTCCCTGAGTGGAGGTGG + Intronic
1154353125 18:13603740-13603762 CAGCGTGCTCAGCGTGGAGTGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156451608 18:37269591-37269613 CTGCCTGGCAAGAGTGGAGGTGG - Intronic
1157007827 18:43607015-43607037 CAACGTGACTAGAGTGGTGCAGG + Intergenic
1157522142 18:48352596-48352618 CAGGGTGAGCAGGCTGGAGGAGG + Intronic
1158848953 18:61474778-61474800 CATCATGACCAGAGTGGCAGGGG + Intronic
1159277205 18:66236206-66236228 AAGGGTGACCATAGTAGAGGAGG + Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1161379809 19:3958973-3958995 CAGCGCCACCAGGCTGGAGGCGG - Exonic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1162091156 19:8280830-8280852 AAGCGCGGCCAGAGTGGACGCGG + Intronic
1162093390 19:8295668-8295690 AAGCGCGGCCAGAGTGGACGCGG + Intronic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1163497905 19:17657248-17657270 CAGCGTGGCCGGAATGGAGGAGG - Intronic
1163909979 19:20180718-20180740 CAGCCTGACCACAGTGGCTGGGG - Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165342871 19:35225020-35225042 CAGCGTCTCCAGACTGGCGGCGG + Exonic
1165829082 19:38721732-38721754 CAGCCTGCCCAGACTGGTGGCGG + Intronic
1165993397 19:39828289-39828311 CAGCTTGGCCAGAGGGTAGGGGG - Exonic
1166745657 19:45140764-45140786 CAATATGACCAGAGTGGATGTGG + Intronic
1166796421 19:45428845-45428867 CAGGGGGGCCCGAGTGGAGGGGG + Intronic
1167369048 19:49070091-49070113 GGGGGTGCCCAGAGTGGAGGTGG + Exonic
925158033 2:1662137-1662159 CAGCGACACAACAGTGGAGGTGG - Exonic
925448605 2:3950114-3950136 CAGCGGCACCAGAGGTGAGGGGG + Intergenic
925499317 2:4486220-4486242 CAGGGTGACCTCAGTAGAGGAGG - Intergenic
926953643 2:18271430-18271452 CAGCGGGAGCAGGGTGGAGGAGG - Intronic
927876216 2:26656952-26656974 GAGGGTGACCAGGGAGGAGGGGG + Intergenic
929489452 2:42383357-42383379 CAGAGTGCTCAGAGTGGATGTGG - Intronic
930086110 2:47498417-47498439 CACCGTGCCCAGCCTGGAGGGGG - Intronic
933253489 2:80054907-80054929 TAGGGTGAAGAGAGTGGAGGGGG + Intronic
934735227 2:96686566-96686588 CACCGTGCCCAGCGAGGAGGTGG - Intergenic
934904582 2:98187498-98187520 CAGCGAGACCATTCTGGAGGAGG - Intronic
935164153 2:100555033-100555055 CAGGGTGAGAGGAGTGGAGGCGG - Intergenic
935504132 2:103878690-103878712 CAGCGAGACCAGAGCTGAGGTGG + Intergenic
936717352 2:115203464-115203486 CAGCATGAACAGATTGGAGAGGG + Intronic
937800776 2:126078010-126078032 AAGGGTGACCTTAGTGGAGGAGG + Intergenic
941696118 2:168552667-168552689 CAGGCTGGCAAGAGTGGAGGAGG + Intronic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
946616673 2:221517541-221517563 CACCTGGACCAGGGTGGAGGAGG + Intronic
948545213 2:238723179-238723201 GAGCGCGGCCAGAGTGGACGCGG + Intergenic
1170782423 20:19437812-19437834 CAGGGGGAACAGGGTGGAGGAGG - Intronic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1176254426 20:64143564-64143586 CACCATGACCTGTGTGGAGGTGG - Intergenic
1178363649 21:31970308-31970330 CACCGTGCCCAGAGAGGAGGTGG + Intronic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1179320999 21:40291186-40291208 CAGGGTGACTGCAGTGGAGGAGG - Intronic
1179646095 21:42777254-42777276 CAGGCTGACCAGGGTGGACGTGG - Intergenic
1179877782 21:44279947-44279969 CAGCATGACCAGACTGGAGAGGG + Intergenic
1180202695 21:46235244-46235266 CAGCCTGACCTGTGGGGAGGGGG - Exonic
1180698955 22:17771426-17771448 CAGCTTGGCCAGGGTGGGGGTGG - Intronic
1181022470 22:20110736-20110758 CATCGTGTCCAGACTGGAGAGGG - Exonic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181311313 22:21946384-21946406 CAGCGTGGCCAGAGACGAGCAGG + Intronic
1181544302 22:23592343-23592365 CAGAGTAATCAGAGAGGAGGTGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182522196 22:30891005-30891027 CAGCTTGGCCAGAGTGTGGGTGG - Intronic
1184019262 22:41809558-41809580 CAGCGCGAGCAGAGAGGTGGAGG + Intronic
1184238560 22:43199693-43199715 CAGCGTGACCTGTGTGGGGCAGG + Exonic
1184361597 22:44022416-44022438 TAGCGTGGCCAGCATGGAGGAGG - Intronic
1184837153 22:47030862-47030884 CACCGTGCCCAGACGGGAGGAGG + Intronic
1185268601 22:49918198-49918220 CGGCGAGACCAGGGAGGAGGCGG - Intronic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
949684818 3:6556750-6556772 CAGGGTGACAAAAGTGGAAGAGG - Intergenic
949896257 3:8769158-8769180 CATCGGGACCCGAGTGGAGGTGG - Intronic
950759481 3:15207729-15207751 CAGTGGGACAAGATTGGAGGTGG - Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
952673030 3:35993990-35994012 CAGCTTGACCACAGTGGAGTAGG + Intergenic
953687742 3:45091410-45091432 CAGCGTGCCCAGAGACCAGGTGG - Exonic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
955712344 3:61793205-61793227 CACCGTGACCAGAATGGGAGTGG + Intronic
957338185 3:78859138-78859160 CAGGGTGACAGTAGTGGAGGTGG + Intronic
957880282 3:86203307-86203329 CAATGTGCCCATAGTGGAGGGGG + Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960349618 3:116576410-116576432 GTGGGTGACCACAGTGGAGGAGG + Intronic
961362414 3:126376194-126376216 CAGAGGAAACAGAGTGGAGGCGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
963206678 3:142643249-142643271 TAGAGTGATCAGAGAGGAGGTGG + Intronic
966183099 3:177204376-177204398 GAGCGTGGCCAGAGTGGGCGCGG + Intergenic
967826234 3:193879773-193879795 CAGCGTGGCAAGGCTGGAGGTGG + Intergenic
968048324 3:195636104-195636126 CAGCGGGACCGGAGAGGCGGAGG + Intergenic
968099080 3:195953516-195953538 CAGCGGGACCGGAGAGGCGGAGG - Intergenic
968306286 3:197653817-197653839 CAGCGGGACCGGAGAGGCGGAGG - Intergenic
969325472 4:6441520-6441542 CAGCCTGAACAGAGGCGAGGTGG - Intronic
969523574 4:7692808-7692830 CCGCGTGTGCAGGGTGGAGGTGG + Intronic
969528828 4:7718308-7718330 CAGCCTGTCCAGACTGAAGGAGG + Intronic
977941990 4:102869031-102869053 CAGCTTGGCCAGAGCGGAGGGGG + Exonic
978065134 4:104388732-104388754 TAGCCTGACCAGAAAGGAGGAGG - Intergenic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
983425636 4:167581445-167581467 AAGCATGGCCAGAGTGGACGCGG - Intergenic
984604268 4:181766525-181766547 TGGGGTGAGCAGAGTGGAGGTGG + Intergenic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985859130 5:2456544-2456566 CAGAGTGACCTGATTGGAGAGGG - Intergenic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
991995463 5:72382172-72382194 CATCGTGGCCAGAGTTGATGAGG + Intergenic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
994081714 5:95714572-95714594 CAGTGTGACCGGAGTGGTGGAGG + Intronic
996537303 5:124591915-124591937 TGGGGTTACCAGAGTGGAGGCGG - Intergenic
997459688 5:134043477-134043499 CAGAATAACCAGAGAGGAGGAGG - Intergenic
997459895 5:134044899-134044921 CAGGATGGCCAGAGTTGAGGGGG - Intergenic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
999976842 5:156920521-156920543 CAGTGTGAGCAGAGTGGCTGCGG + Intronic
1002671823 5:180873690-180873712 CATGGTGACAAGACTGGAGGAGG - Intergenic
1002836496 6:869273-869295 CAGAGTGCCCAGCGTGGAGCAGG + Intergenic
1005496603 6:26393053-26393075 TTACGTGACCAGAGGGGAGGAGG - Exonic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1006108428 6:31730060-31730082 CAGCGCGACAGGAGTGGGGGTGG - Intronic
1006202920 6:32312817-32312839 AAGAGTGATCAGAGTGGAAGTGG - Intronic
1006203571 6:32319298-32319320 GAGAGTGATCAGAGTGGAAGTGG - Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1007933182 6:45710670-45710692 TAGCGTGACCAGAGCCGTGGGGG - Intergenic
1008487081 6:52048026-52048048 CAACGTGACCACAGAGGCGGTGG + Intronic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1011247687 6:85336867-85336889 CAGAGTGACCAGAGAAGAAGAGG + Intergenic
1014251244 6:119117500-119117522 CAAGGTGACCACAGTGGAAGAGG - Intronic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1019146168 6:169976794-169976816 AAGTGTGACCAGGGAGGAGGAGG - Intergenic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1022737078 7:33086267-33086289 CAGCGGGTCCAGAGAGGATGGGG - Intergenic
1024517511 7:50271952-50271974 AAGAGTGACGAGGGTGGAGGAGG + Intergenic
1024614557 7:51100032-51100054 CAGGATTACCACAGTGGAGGTGG - Intronic
1026152101 7:67796608-67796630 AAGTGTGACCAGCCTGGAGGTGG + Intergenic
1029065409 7:97843342-97843364 AAGCGCGGCCAGAGTGGATGCGG + Intergenic
1031554233 7:123151877-123151899 CAGGGTGACAACAGTGGAGGTGG - Intronic
1033571358 7:142631964-142631986 CAGTGTGAACAGAGTTGATGCGG + Intergenic
1035168025 7:157003070-157003092 CACCGTGCCCGGAGTGGATGAGG + Intronic
1035392956 7:158517521-158517543 CAGCGAGGCCAGTGAGGAGGTGG - Intronic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1039363137 8:36901853-36901875 AAGCCTGACCAAGGTGGAGGGGG - Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1041120251 8:54579427-54579449 CAACGTGACAAGAGAGGAGTTGG - Intergenic
1041640446 8:60194306-60194328 CAACAAAACCAGAGTGGAGGCGG + Intronic
1043224001 8:77700611-77700633 GAGCGTGGGCAGAGTGGATGCGG - Intergenic
1044414687 8:91924012-91924034 CAGTGGGACAAGATTGGAGGTGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049569702 8:143363531-143363553 CAGGCTGCCAAGAGTGGAGGAGG - Intergenic
1056179195 9:84065131-84065153 CAGTGGGACCAGAGTGGGTGGGG - Intergenic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1061519263 9:131108013-131108035 CAGCGTCAGCTAAGTGGAGGCGG + Intronic
1061618955 9:131798489-131798511 CAGCCTGCCCAGGGTGGAGAAGG + Intergenic
1062488405 9:136792273-136792295 CGGGGTGACGAGAGTGGAGTCGG + Exonic
1062547626 9:137070748-137070770 CTGCGAGGCCAGAGTGGAGCAGG - Intergenic
1185570856 X:1133827-1133849 CAGCCTCACCAGAGTGGGGAGGG - Intergenic
1185755660 X:2651137-2651159 GAGCGTGCCCAGTGGGGAGGCGG - Intergenic
1190866377 X:54388351-54388373 CAGGGGGACAAAAGTGGAGGAGG - Intergenic
1192549322 X:72041568-72041590 CAGCCTCAGGAGAGTGGAGGGGG + Intergenic
1194974958 X:100385222-100385244 CAGCTTCACCAGATTGGTGGTGG + Intronic
1196354532 X:114774922-114774944 AAGCGGTACCAGAGTGCAGGAGG - Intronic
1197712311 X:129680155-129680177 CAGAGTGAACAGATTGGAGGGGG + Intergenic
1197721058 X:129744957-129744979 CAGTGTGAACAGTGTGGGGGCGG + Intronic
1197785298 X:130191989-130192011 CTGCCTGACCAGAGTGTTGGGGG - Intergenic
1198447130 X:136728353-136728375 CAGTGTGACCAAAGTGGCTGTGG - Intronic
1200239711 X:154487059-154487081 CAGCCAGACCAGAAAGGAGGAGG - Intergenic