ID: 1148678137

View in Genome Browser
Species Human (GRCh38)
Location 17:49456969-49456991
Sequence CTTACATGCTTACAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148678137_1148678152 27 Left 1148678137 17:49456969-49456991 CCTCCACCCTGTAAGCATGTAAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1148678152 17:49457019-49457041 TCTCTGGGGTGTGCCTGGGGAGG 0: 1
1: 0
2: 3
3: 45
4: 391
1148678137_1148678150 23 Left 1148678137 17:49456969-49456991 CCTCCACCCTGTAAGCATGTAAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1148678150 17:49457015-49457037 CTCTTCTCTGGGGTGTGCCTGGG 0: 1
1: 0
2: 1
3: 20
4: 270
1148678137_1148678146 13 Left 1148678137 17:49456969-49456991 CCTCCACCCTGTAAGCATGTAAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1148678146 17:49457005-49457027 CCTCCCACTTCTCTTCTCTGGGG 0: 1
1: 3
2: 35
3: 113
4: 495
1148678137_1148678143 11 Left 1148678137 17:49456969-49456991 CCTCCACCCTGTAAGCATGTAAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1148678143 17:49457003-49457025 AGCCTCCCACTTCTCTTCTCTGG 0: 1
1: 0
2: 4
3: 55
4: 371
1148678137_1148678149 22 Left 1148678137 17:49456969-49456991 CCTCCACCCTGTAAGCATGTAAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1148678149 17:49457014-49457036 TCTCTTCTCTGGGGTGTGCCTGG 0: 1
1: 0
2: 2
3: 16
4: 261
1148678137_1148678151 24 Left 1148678137 17:49456969-49456991 CCTCCACCCTGTAAGCATGTAAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1148678151 17:49457016-49457038 TCTTCTCTGGGGTGTGCCTGGGG 0: 1
1: 0
2: 3
3: 34
4: 313
1148678137_1148678144 12 Left 1148678137 17:49456969-49456991 CCTCCACCCTGTAAGCATGTAAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1148678144 17:49457004-49457026 GCCTCCCACTTCTCTTCTCTGGG 0: 1
1: 0
2: 3
3: 50
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148678137 Original CRISPR CTTACATGCTTACAGGGTGG AGG (reversed) Intronic
911087769 1:93993491-93993513 CATACATGCTTACATCCTGGGGG + Intronic
915295019 1:154914215-154914237 CTTACTTGCTCACAGCATGGTGG + Intergenic
917294758 1:173506851-173506873 CTTACCTGCTCACAGGTTGTAGG + Exonic
921064920 1:211616013-211616035 CTTACATTCTTACAGGGGAGTGG - Intergenic
1064720956 10:18228018-18228040 TTTACATTCTTTCAGGGTAGGGG + Intronic
1071138810 10:82482851-82482873 CCTACAGGATTACAGTGTGGGGG + Intronic
1072819030 10:98538038-98538060 GTCACATGATTACAGGATGGGGG - Intronic
1073669025 10:105566640-105566662 CTGACTTGCTTACATGGTAGTGG + Intergenic
1074886575 10:117698775-117698797 CTCACATGCTCAGAGGGTTGAGG - Intergenic
1078281341 11:9904037-9904059 CTGACATTCCTAGAGGGTGGGGG + Intronic
1078854867 11:15198990-15199012 CTAACATGCTCGGAGGGTGGGGG - Intronic
1080788621 11:35499290-35499312 CATACATCTGTACAGGGTGGGGG - Intronic
1083115511 11:60455599-60455621 CACACCTGCTTATAGGGTGGGGG + Intergenic
1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG + Intergenic
1085733611 11:79019990-79020012 CTAACAGGCTGGCAGGGTGGTGG - Intronic
1088828667 11:113516855-113516877 CCTACCTGGGTACAGGGTGGAGG + Intergenic
1089085576 11:115814444-115814466 CTAATATGTTTACAGGTTGGGGG - Intergenic
1089670359 11:120052572-120052594 CTTGCATGCTTGCAGGGCTGGGG - Intergenic
1092071427 12:5634505-5634527 CATTCATGCTTATTGGGTGGGGG - Intronic
1097685632 12:62688266-62688288 CCTTCATGGTTACAAGGTGGTGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1102013488 12:109633047-109633069 CATAAATGCTTAAAGGGTGCAGG + Intergenic
1102723714 12:115039811-115039833 CTTACAGGGTTACAGGGTTAGGG - Intergenic
1102945918 12:116987910-116987932 CTGACATGTGTACAAGGTGGGGG - Intronic
1103644909 12:122383957-122383979 CTTACATGTTGGGAGGGTGGGGG - Intronic
1106001574 13:25728403-25728425 ATTACCTGCTTAGAGAGTGGGGG + Intronic
1106482688 13:30148616-30148638 CTGAGATGCTGTCAGGGTGGAGG + Intergenic
1107340834 13:39403796-39403818 CTTACATGTTTATACAGTGGTGG - Intronic
1107728144 13:43320509-43320531 CGTACATGCTTATAGGATCGGGG - Intronic
1108483032 13:50894572-50894594 CTGACATACTTACAGGGTCTTGG - Intergenic
1111433137 13:88170469-88170491 CTTACACCCATACAGGGAGGAGG - Intergenic
1118474257 14:66102154-66102176 CTTACATGGGTACAGGATAGGGG - Intergenic
1119083592 14:71719964-71719986 CTTACAGGCCCACAGAGTGGGGG - Intronic
1119917323 14:78414013-78414035 CTTACATGCTGACAGGCAAGAGG - Intronic
1120780907 14:88484526-88484548 CTTAAAGGCTAATAGGGTGGTGG + Intronic
1124322256 15:28723860-28723882 CCTACAAGGTTACAAGGTGGTGG - Intronic
1124535312 15:30540502-30540524 CCTACAAGGTTACAAGGTGGTGG + Intergenic
1127169480 15:56285497-56285519 CTGGCAAACTTACAGGGTGGTGG - Intronic
1128646562 15:69382984-69383006 CTTGCATGCTTCCAGGGATGGGG - Intronic
1132803505 16:1765411-1765433 CTTACCTGGTTAGAGGGTGACGG + Intronic
1133106264 16:3511787-3511809 GTTACATGCTCACAGGCTGCGGG - Intronic
1133666550 16:7973688-7973710 CTTTGATGCTTACAGGAAGGGGG + Intergenic
1139068197 16:63345686-63345708 CTCTCCTGCATACAGGGTGGGGG - Intergenic
1140973052 16:80031883-80031905 CTGACAGGCTTACAGAGTGGAGG + Intergenic
1144077256 17:11730381-11730403 CTTACATCCTTACAAGGCAGAGG - Intronic
1144750051 17:17642242-17642264 CTTAAATACGTCCAGGGTGGGGG + Intergenic
1148080037 17:44962940-44962962 CTTCCATCCTTAGATGGTGGGGG + Intronic
1148678137 17:49456969-49456991 CTTACATGCTTACAGGGTGGAGG - Intronic
1152055466 17:78022145-78022167 CTTACATTTTTAAAGGATGGGGG - Intronic
1152550404 17:81027016-81027038 CTTAGGTGCCTAGAGGGTGGGGG - Intergenic
1154255625 18:12778685-12778707 CATACATACATACAGGTTGGGGG - Intergenic
1156959016 18:43000720-43000742 CTTACATGGCTGCAGGGGGGTGG - Intronic
1164755549 19:30686412-30686434 CATACACACTCACAGGGTGGGGG - Intronic
1166728795 19:45045917-45045939 CTTCCCTGCTAACAGGGAGGGGG - Intronic
925139731 2:1541817-1541839 CTTACTTGCATACAGGAGGGGGG + Intronic
925906999 2:8545581-8545603 CTGAGAGGCTGACAGGGTGGTGG - Intergenic
932923397 2:75942535-75942557 TTTACATGCTTATAGGCTGAAGG + Intergenic
933985004 2:87583703-87583725 CAATCATGCTCACAGGGTGGTGG - Intergenic
935966172 2:108478881-108478903 CACACATGCATACAGGGTTGAGG - Intronic
936308842 2:111367108-111367130 CAATCATGCTCACAGGGTGGTGG + Intergenic
936470811 2:112797296-112797318 GTTGCATCCTTACACGGTGGAGG + Intergenic
936994894 2:118403068-118403090 CTTACATGCTGACGCAGTGGAGG - Intergenic
938111389 2:128568385-128568407 CCGACCTGCTTACAGAGTGGTGG - Intergenic
940426954 2:153541158-153541180 CTATCATGATAACAGGGTGGGGG - Intergenic
941653524 2:168119071-168119093 CTCACATGCTCACAGGGAGGAGG - Intronic
942486731 2:176447614-176447636 CTTACATGCTTACAAGGTGCAGG - Intergenic
942962512 2:181849003-181849025 TTAAGATGCTTGCAGGGTGGAGG + Intergenic
943705360 2:191028331-191028353 CCTAAATGCTTTTAGGGTGGAGG - Intergenic
943808476 2:192153941-192153963 CTTAAATTCTTACATGGTTGGGG + Intronic
1173775676 20:45704315-45704337 CTTGCATGGTTCCAGGGTGGTGG - Intronic
1181405353 22:22680621-22680643 CTTTCATCCTTCCAGGGTAGGGG - Intergenic
1184497420 22:44850027-44850049 ATTACATGGTTAGAGGGTGCGGG + Intronic
1185133984 22:49058277-49058299 AATGCATGCTTACAGGGTGGTGG + Intergenic
953098694 3:39805027-39805049 ATAACAATCTTACAGGGTGGTGG + Intergenic
956856015 3:73275538-73275560 CTTACATGGTGGCAGGGTGGTGG + Intergenic
961545674 3:127631135-127631157 CTCAGGTGCTTACAGAGTGGAGG + Intronic
961697030 3:128712522-128712544 CCTCCATGCTGACAGGGTTGTGG - Intergenic
963757995 3:149256114-149256136 CTTACATGTGAAGAGGGTGGAGG + Intergenic
965782688 3:172304411-172304433 CTGACATACTTACTGGGTGGAGG + Intronic
965824138 3:172713810-172713832 TTTATATGCTTGGAGGGTGGTGG + Intergenic
967751661 3:193122481-193122503 CTTACTTGCTGACAGGGAGAGGG + Intergenic
971359824 4:25926945-25926967 CTTACATGTCTATAGGATGGTGG + Intronic
971478991 4:27097863-27097885 CTCACATCCTTATAGGGTGAAGG - Intergenic
974598772 4:64048331-64048353 CTCACATGGTCAAAGGGTGGTGG - Intergenic
981256203 4:142662588-142662610 CTTAAATGCTTTCAGCATGGAGG - Intronic
985871379 5:2560089-2560111 CTTACAGGCTTTCAGGGAGTGGG - Intergenic
993426805 5:87775452-87775474 CTTACATGCTTACAGACGGAAGG + Intergenic
994116361 5:96065683-96065705 GATCCATGCCTACAGGGTGGAGG - Intergenic
994306922 5:98216295-98216317 CTTTCATGATTTCAGGGTGTGGG - Intergenic
997449656 5:133971606-133971628 CTTCCAGGCTTTCAGGGTTGTGG - Intergenic
998151747 5:139761509-139761531 CTTACAGGCTTATAGGGCTGAGG - Intergenic
999501434 5:152150480-152150502 CTCAAATGCTTACAGGGTCCAGG - Intergenic
1001257343 5:170194049-170194071 CTTACATGCCTCCAGTGAGGAGG - Intergenic
1001924971 5:175629484-175629506 CTTAAATGATTCCAGGGTAGAGG + Intergenic
1002449843 5:179312415-179312437 CTCACATGCTGAAAGGGTGAGGG - Intronic
1007761800 6:44137661-44137683 TTTACATGCCTGGAGGGTGGAGG + Intronic
1008571031 6:52816807-52816829 CTTACATTATTACAAGATGGGGG - Intergenic
1008840735 6:55900181-55900203 CATAAATGCTGGCAGGGTGGAGG - Intergenic
1010799807 6:80162358-80162380 CTTACATTCTTTCAGAGTGCAGG - Intronic
1018534684 6:164807614-164807636 CTCACATGATTACAAGGTGAAGG + Intergenic
1021324517 7:19249388-19249410 AGTACATGATTTCAGGGTGGAGG - Intergenic
1022137715 7:27465300-27465322 CTGACAGAATTACAGGGTGGTGG - Intergenic
1024173156 7:46810905-46810927 TTTATATGGTTACAGGATGGGGG + Intergenic
1027601274 7:80244538-80244560 CTTACATGTTGACAGAATGGAGG - Intergenic
1031996363 7:128234392-128234414 CTTTCATGATTTCAGGGTAGTGG + Intergenic
1033463007 7:141564479-141564501 CTTTCATGAGCACAGGGTGGAGG + Intronic
1033635759 7:143209975-143209997 CTTACACGGGTACAGGATGGGGG + Intergenic
1039301560 8:36214771-36214793 CTTTCAGGCTCACAGGGTGTGGG + Intergenic
1040318467 8:46277180-46277202 CTTGCATGCCTCCCGGGTGGGGG - Intergenic
1040997128 8:53413514-53413536 GTTAACTGCTGACAGGGTGGAGG + Intergenic
1042240613 8:66660455-66660477 CTCAAACCCTTACAGGGTGGTGG + Intronic
1046424516 8:114029439-114029461 CTCTCATGCCTACAGGGTGATGG + Intergenic
1046447502 8:114341982-114342004 CTGACATGCCTAGTGGGTGGGGG - Intergenic
1050162400 9:2732135-2732157 CTTACGTGCTTTCAGGAGGGAGG + Intronic
1051664931 9:19459863-19459885 CTGACATGCATTCAGTGTGGGGG + Intergenic
1052669543 9:31538573-31538595 CTGACATTCCTACTGGGTGGGGG - Intergenic
1055076268 9:72218390-72218412 CTTACATGCTCACAGAGAGGAGG + Intronic
1055311633 9:74988751-74988773 CTTACATTCTTAAAGGGTAATGG - Intronic
1189839402 X:45057373-45057395 ATTAGATGTTCACAGGGTGGGGG - Intronic
1195471367 X:105234231-105234253 CTTATATGCTGTCAGGCTGGAGG - Intronic
1197470410 X:126861425-126861447 CTGACATTCCTAGAGGGTGGGGG - Intergenic
1199902333 X:152188482-152188504 CTTATATTCTTCCTGGGTGGGGG + Intronic