ID: 1148683090

View in Genome Browser
Species Human (GRCh38)
Location 17:49485901-49485923
Sequence CGGGAAGCCACCGACTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148683090_1148683104 20 Left 1148683090 17:49485901-49485923 CCAGCTGAGTCGGTGGCTTCCCG No data
Right 1148683104 17:49485944-49485966 TTGTTTAGTGGGATTCTCAGTGG No data
1148683090_1148683097 8 Left 1148683090 17:49485901-49485923 CCAGCTGAGTCGGTGGCTTCCCG No data
Right 1148683097 17:49485932-49485954 GCCCCCCTCATTTTGTTTAGTGG No data
1148683090_1148683105 23 Left 1148683090 17:49485901-49485923 CCAGCTGAGTCGGTGGCTTCCCG No data
Right 1148683105 17:49485947-49485969 TTTAGTGGGATTCTCAGTGGTGG No data
1148683090_1148683099 9 Left 1148683090 17:49485901-49485923 CCAGCTGAGTCGGTGGCTTCCCG No data
Right 1148683099 17:49485933-49485955 CCCCCCTCATTTTGTTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148683090 Original CRISPR CGGGAAGCCACCGACTCAGC TGG (reversed) Intergenic
No off target data available for this crispr