ID: 1148684329

View in Genome Browser
Species Human (GRCh38)
Location 17:49492443-49492465
Sequence CACTTGAACCAAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148684324_1148684329 9 Left 1148684324 17:49492411-49492433 CCTAGTTACTCGGGAGGCTGAGG 0: 2135
1: 110425
2: 295753
3: 223802
4: 122394
Right 1148684329 17:49492443-49492465 CACTTGAACCAAGGAGACGGAGG No data
1148684322_1148684329 17 Left 1148684322 17:49492403-49492425 CCTGTAATCCTAGTTACTCGGGA 0: 53
1: 3231
2: 60288
3: 230771
4: 263931
Right 1148684329 17:49492443-49492465 CACTTGAACCAAGGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148684329 Original CRISPR CACTTGAACCAAGGAGACGG AGG Intergenic
No off target data available for this crispr