ID: 1148685163

View in Genome Browser
Species Human (GRCh38)
Location 17:49496763-49496785
Sequence CCGGGCGCCCCCGTCTCGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685163_1148685168 0 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685168 17:49496786-49496808 ACGCCTCGGATTCTGTAGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 9
1148685163_1148685170 8 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685170 17:49496794-49496816 GATTCTGTAGCGCGGTATCCCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1148685163_1148685171 9 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685171 17:49496795-49496817 ATTCTGTAGCGCGGTATCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1148685163_1148685175 27 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685175 17:49496813-49496835 CCGGGCCACCGACTCGGCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 26
1148685163_1148685172 21 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685172 17:49496807-49496829 GGTATCCCGGGCCACCGACTCGG 0: 1
1: 0
2: 1
3: 0
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685163 Original CRISPR CCGGGCGCCCCCGTCTCGTT AGG (reversed) Intronic