ID: 1148685163

View in Genome Browser
Species Human (GRCh38)
Location 17:49496763-49496785
Sequence CCGGGCGCCCCCGTCTCGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685163_1148685170 8 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685170 17:49496794-49496816 GATTCTGTAGCGCGGTATCCCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1148685163_1148685171 9 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685171 17:49496795-49496817 ATTCTGTAGCGCGGTATCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1148685163_1148685172 21 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685172 17:49496807-49496829 GGTATCCCGGGCCACCGACTCGG 0: 1
1: 0
2: 1
3: 0
4: 51
1148685163_1148685168 0 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685168 17:49496786-49496808 ACGCCTCGGATTCTGTAGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 9
1148685163_1148685175 27 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685175 17:49496813-49496835 CCGGGCCACCGACTCGGCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685163 Original CRISPR CCGGGCGCCCCCGTCTCGTT AGG (reversed) Intronic
904424930 1:30417101-30417123 CCGGGCACCCCCGCGTAGTTGGG + Intergenic
908128736 1:61053978-61054000 CCGGGCGCCGCCCTCTGGCTCGG - Intronic
912010067 1:104948220-104948242 CCGGGCGTGCCCGTCTCTTATGG + Intergenic
914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG + Intronic
918097856 1:181349367-181349389 CGGGGAGCCCCAGTCTTGTTGGG + Intergenic
1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG + Intergenic
1077156401 11:1093908-1093930 CTGGGTGGCCCCGTCTCTTTGGG + Intergenic
1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG + Exonic
1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG + Exonic
1133156765 16:3881090-3881112 CCGGGCCCGCCCGTCCCGCTGGG + Intergenic
1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG + Exonic
1148557153 17:48585446-48585468 CCGGGCCCCCCCGCATCGTTGGG - Intronic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG + Exonic
1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG + Intronic
1160872650 19:1284164-1284186 CCGGGCGGCTCCGTCTGGTGGGG - Intergenic
1160909219 19:1467206-1467228 CCCGGCGCCCCCGCCGCGCTCGG - Exonic
1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG + Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
934763891 2:96869898-96869920 CCGGGCGCCGCCCTCGCGTTCGG + Exonic
945234813 2:207624761-207624783 CCGGGCGCCCGGGTCTGGGTTGG - Intronic
948007767 2:234624420-234624442 CCTGGGGCCCCCGTATCCTTGGG + Intergenic
1176550697 21:8219559-8219581 CGGAGCGTCCCCGTCTCGGTCGG + Intergenic
1176577539 21:8446829-8446851 CGGAGCGTCCCCGTCTCGGTCGG + Intergenic
1184129457 22:42509142-42509164 CCTGGCGCCCATGTCTCCTTGGG - Intergenic
1203255598 22_KI270733v1_random:135902-135924 CGGAGCGTCCCCGTCTCGGTCGG + Intergenic
1203255949 22_KI270733v1_random:138054-138076 CGGAGCGTCCCCGTCTCGGTCGG + Intergenic
966362875 3:179148673-179148695 CCGGGCGCGCCCGCCGTGTTGGG + Intronic
1018134661 6:160767526-160767548 CCGGGCGCCCTCGCCTCCCTGGG - Intergenic
1019386565 7:760055-760077 CCGCGCGGCCCCGTCTCCCTCGG - Intronic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1048484000 8:134831477-134831499 CCGGGAGCACCCGTCTGGATGGG - Intergenic
1203471995 Un_GL000220v1:119037-119059 CGGAGCGTCCCCGTCTCGGTCGG + Intergenic