ID: 1148685168

View in Genome Browser
Species Human (GRCh38)
Location 17:49496786-49496808
Sequence ACGCCTCGGATTCTGTAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 9}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685158_1148685168 10 Left 1148685158 17:49496753-49496775 CCGCTGGGCACCTAACGAGACGG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1148685168 17:49496786-49496808 ACGCCTCGGATTCTGTAGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 9
1148685155_1148685168 28 Left 1148685155 17:49496735-49496757 CCTGGCTCTCGGTGCAAGCCGCT 0: 1
1: 0
2: 0
3: 22
4: 172
Right 1148685168 17:49496786-49496808 ACGCCTCGGATTCTGTAGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 9
1148685163_1148685168 0 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685168 17:49496786-49496808 ACGCCTCGGATTCTGTAGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685168 Original CRISPR ACGCCTCGGATTCTGTAGCG CGG Intronic
1076590563 10:131579620-131579642 ACGCCTCGCTTTCTGGAGGGTGG + Intergenic
1077092128 11:783576-783598 CCGCCTGGGATTCTGAGGCGTGG - Exonic
1094652521 12:32391668-32391690 ACACCTCAGATTCTGTAGCTGGG - Intergenic
1145263223 17:21366828-21366850 AAGACTCGGATTCTGCAGAGGGG - Intergenic
1148685168 17:49496786-49496808 ACGCCTCGGATTCTGTAGCGCGG + Intronic
1152189573 17:78880175-78880197 ACGCCACGGCTTCTGTGGCACGG + Intronic
1173132898 20:40411388-40411410 AGGCCTGGGATTCTGAAGAGGGG - Intergenic
950044829 3:9943001-9943023 AGGCCTCCGCTTCTGGAGCGTGG + Intronic
1001788663 5:174436224-174436246 AAGTCTTGGATTCTGTAGCTAGG - Intergenic
1003052723 6:2794442-2794464 AAGCATCGTCTTCTGTAGCGGGG - Intergenic
1062000570 9:134213860-134213882 AGGCCTAGGATTCTGTCCCGGGG - Intergenic