ID: 1148685170

View in Genome Browser
Species Human (GRCh38)
Location 17:49496794-49496816
Sequence GATTCTGTAGCGCGGTATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685158_1148685170 18 Left 1148685158 17:49496753-49496775 CCGCTGGGCACCTAACGAGACGG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1148685170 17:49496794-49496816 GATTCTGTAGCGCGGTATCCCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1148685163_1148685170 8 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685170 17:49496794-49496816 GATTCTGTAGCGCGGTATCCCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1148685166_1148685170 -10 Left 1148685166 17:49496781-49496803 CCCGGACGCCTCGGATTCTGTAG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1148685170 17:49496794-49496816 GATTCTGTAGCGCGGTATCCCGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685170 Original CRISPR GATTCTGTAGCGCGGTATCC CGG Intronic
907671258 1:56476909-56476931 GATTCAGAAGAGTGGTATCCAGG - Intergenic
910607313 1:89100783-89100805 GATTCTGTAGCTCCCTTTCCAGG - Intergenic
917723479 1:177808618-177808640 CATTCTGTAGCTGGGTCTCCAGG - Intergenic
1073953599 10:108840541-108840563 GATTCTGGGGCCAGGTATCCTGG - Intergenic
1110410151 13:75195909-75195931 AGTTCTGTAGCATGGTATCCTGG - Intergenic
1116328476 14:43565329-43565351 GATGCTGCAGCACTGTATCCAGG - Intergenic
1120639683 14:86995677-86995699 GCTTTTGGAGCGAGGTATCCTGG - Intergenic
1137404369 16:48178229-48178251 GATTCTGTAGCCAGATTTCCTGG - Intronic
1148685170 17:49496794-49496816 GATTCTGTAGCGCGGTATCCCGG + Intronic
1148823277 17:50373324-50373346 GATTCTGCAGAGCGGTGTTCAGG - Intronic
1150957395 17:69874238-69874260 GATTCTGTAGGGCAGTACACTGG + Intergenic
1160219039 18:76959158-76959180 GATTCTGAAGTGCGTTCTCCCGG - Intronic
1164862026 19:31569136-31569158 CTTTCTGTAGCGAGGTGTCCAGG - Intergenic
1167792269 19:51689753-51689775 GATTCTGGACCCCGGGATCCAGG - Intergenic
939285420 2:140122817-140122839 GAAGCTGTAGCGAGTTATCCAGG - Intergenic
947933438 2:233983298-233983320 GCTTCTGAAGTGCGGTCTCCGGG - Intronic
1171939409 20:31311203-31311225 GATGCTGCAGCGAGTTATCCAGG - Intergenic
952148611 3:30561584-30561606 GGCTCTGTAGCATGGTATCCTGG - Intergenic
966332716 3:178833183-178833205 GATTCTGAAGGGCTGCATCCTGG - Intronic
969053502 4:4387917-4387939 GATTCTGGATCGCGGGATGCTGG + Intronic
982032553 4:151315104-151315126 GATTCTGTAGCATGGACTCCTGG - Intronic
989654545 5:43732331-43732353 GATTCTTTATCGAGGTATGCAGG - Intergenic
990145073 5:52750562-52750584 GATCCTGTAGCTCGTTATCCAGG - Intergenic
990418635 5:55610657-55610679 AATTCTTTAGCTTGGTATCCAGG - Intergenic
1015917531 6:138232581-138232603 GATTCTGTAGCTTGCTATCAGGG + Intronic
1023679738 7:42673427-42673449 GATTCTGTGGGTCGGTATTCTGG + Intergenic