ID: 1148685171

View in Genome Browser
Species Human (GRCh38)
Location 17:49496795-49496817
Sequence ATTCTGTAGCGCGGTATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685163_1148685171 9 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685171 17:49496795-49496817 ATTCTGTAGCGCGGTATCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1148685158_1148685171 19 Left 1148685158 17:49496753-49496775 CCGCTGGGCACCTAACGAGACGG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1148685171 17:49496795-49496817 ATTCTGTAGCGCGGTATCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1148685167_1148685171 -10 Left 1148685167 17:49496782-49496804 CCGGACGCCTCGGATTCTGTAGC 0: 1
1: 0
2: 0
3: 3
4: 19
Right 1148685171 17:49496795-49496817 ATTCTGTAGCGCGGTATCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1148685166_1148685171 -9 Left 1148685166 17:49496781-49496803 CCCGGACGCCTCGGATTCTGTAG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1148685171 17:49496795-49496817 ATTCTGTAGCGCGGTATCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685171 Original CRISPR ATTCTGTAGCGCGGTATCCC GGG Intronic
906590506 1:47020699-47020721 ATTTTGTGGAGCTGTATCCCAGG - Intergenic
1070641547 10:78173958-78173980 ATTCTGCAGCCCAGTATCCCTGG + Intergenic
1075419118 10:122287831-122287853 ATTCTCTAGCGTGGAATCCAAGG + Intronic
1087715733 11:101606756-101606778 ATTCTGTAGCCTCCTATCCCAGG + Intronic
1092990859 12:13897638-13897660 ATTTTCTAGCGGGGAATCCCAGG - Intronic
1110410150 13:75195908-75195930 GTTCTGTAGCATGGTATCCTGGG - Intergenic
1119767003 14:77196425-77196447 ATTCTGAAGGGCGCTGTCCCAGG + Intronic
1137545530 16:49400486-49400508 ATTCTGTACCGGAGTATCTCTGG - Intergenic
1148685171 17:49496795-49496817 ATTCTGTAGCGCGGTATCCCGGG + Intronic
1165100794 19:33437499-33437521 ATTCTGGAGTGCTGTCTCCCAGG - Intronic
937078298 2:119123219-119123241 ATTCTGTAGCTGGGTGTCTCCGG - Intergenic
947490586 2:230591371-230591393 ATTCTGGATCACGGTACCCCTGG - Intergenic
947969219 2:234308024-234308046 ATTCTGTTGCCCTGGATCCCAGG - Intergenic
1168987693 20:2064395-2064417 AGTCTGTAGTGCAGTATCTCTGG - Intergenic
1175704844 20:61169037-61169059 ATTGTGTAACGCAGGATCCCTGG - Intergenic
958173892 3:89970938-89970960 ATTCTGTTGCCTGGTATCCTTGG - Intergenic
998475173 5:142414417-142414439 CTTCTTTACCGCTGTATCCCTGG + Intergenic
1004150461 6:13114726-13114748 ATGCTGTTGAGCTGTATCCCTGG - Intronic
1007732103 6:43953696-43953718 ATTCTGCAGAGCGGTCTCCATGG + Intergenic
1011549498 6:88516662-88516684 ATTCTGTAGCACGCTAGTCCAGG + Intergenic
1038774681 8:30518225-30518247 ATTCTGTAGGGCAGAATTCCAGG + Intronic
1060254533 9:122015528-122015550 CTTCTGAAGCACGGCATCCCTGG - Intronic
1192368640 X:70495822-70495844 ATTCTTTAGCGTGGTATCACTGG - Intronic