ID: 1148685172

View in Genome Browser
Species Human (GRCh38)
Location 17:49496807-49496829
Sequence GGTATCCCGGGCCACCGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685169_1148685172 -5 Left 1148685169 17:49496789-49496811 CCTCGGATTCTGTAGCGCGGTAT 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1148685172 17:49496807-49496829 GGTATCCCGGGCCACCGACTCGG 0: 1
1: 0
2: 1
3: 0
4: 51
1148685166_1148685172 3 Left 1148685166 17:49496781-49496803 CCCGGACGCCTCGGATTCTGTAG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1148685172 17:49496807-49496829 GGTATCCCGGGCCACCGACTCGG 0: 1
1: 0
2: 1
3: 0
4: 51
1148685163_1148685172 21 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685172 17:49496807-49496829 GGTATCCCGGGCCACCGACTCGG 0: 1
1: 0
2: 1
3: 0
4: 51
1148685167_1148685172 2 Left 1148685167 17:49496782-49496804 CCGGACGCCTCGGATTCTGTAGC 0: 1
1: 0
2: 0
3: 3
4: 19
Right 1148685172 17:49496807-49496829 GGTATCCCGGGCCACCGACTCGG 0: 1
1: 0
2: 1
3: 0
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685172 Original CRISPR GGTATCCCGGGCCACCGACT CGG Intronic
903708779 1:25306498-25306520 GGTATCCGGGGCCACCAAAGGGG - Intronic
903718333 1:25385920-25385942 GGTATCCGGCGCCACCAAATGGG + Intronic
905401072 1:37703738-37703760 GGCATCCCAGGCCAAGGACTCGG - Intronic
907321185 1:53603393-53603415 GGTATCCCGGGGCAGAGTCTAGG - Intronic
922785114 1:228278765-228278787 GGTGTCCCGGGCCAGCGCCCAGG + Exonic
1074095059 10:110304623-110304645 GGGATCCAGGGCCAGCGCCTGGG + Intronic
1077325901 11:1963995-1964017 GGTGCCCCGGGCCACCCACATGG + Intronic
1084165754 11:67373974-67373996 GGTGTCCCAGGCCAACGCCTGGG - Intronic
1202808881 11_KI270721v1_random:19174-19196 GGTGCCCCGGGCCACCCACATGG + Intergenic
1096716381 12:53493843-53493865 GGTATCCAGGGCCAGCAGCTGGG + Exonic
1125954151 15:43777566-43777588 CGTATCCCTGCCCACCAACTGGG - Intronic
1132574239 16:657309-657331 GGTTTCCTGGTGCACCGACTGGG + Intronic
1135734148 16:24917408-24917430 GGAATCCCGGGCCACAGAACGGG + Intergenic
1136292976 16:29287012-29287034 GGGAGCCCGGGCCAGCGTCTGGG + Intergenic
1142098860 16:88261017-88261039 GGGAGCCCGGGCCAGCGTCTGGG + Intergenic
1148685172 17:49496807-49496829 GGTATCCCGGGCCACCGACTCGG + Intronic
1152751171 17:82063093-82063115 GGCAGCCCGGGCCACCATCTGGG + Intronic
1166957006 19:46471399-46471421 GGTAGCCGGAGCCAGCGACTGGG - Exonic
1168719978 19:58549507-58549529 GGGTTCCCGGGCCACCACCTGGG - Exonic
932205136 2:69873777-69873799 GTTCTCCCAGGCCACTGACTTGG - Intronic
1175756959 20:61536088-61536110 GGTAGCCTGGGCCACTCACTGGG - Intronic
1181313660 22:21958723-21958745 GGTCACTGGGGCCACCGACTTGG + Intronic
1183388349 22:37528058-37528080 GGTCTCCCTGCCCACCGAGTAGG + Intergenic
952448167 3:33404010-33404032 GCTATCCTGGGCTACCGCCTTGG - Intronic
955601001 3:60645052-60645074 GGGATCCCTGGCCACCCACCTGG - Intronic
984684431 4:182650207-182650229 GGCATCCCCGGCCACAGACATGG - Intronic
999627632 5:153537049-153537071 GGGTTCCCTGGCCACCAACTAGG - Intronic
1007387737 6:41530954-41530976 TGTATCCCAGGCCACCTGCTGGG - Intergenic
1018385310 6:163297987-163298009 GGTATCCCGGGCCACCACCTTGG - Intronic
1019551927 7:1607394-1607416 GGGCTCCCGGGCCCCCGGCTGGG + Intergenic
1020264129 7:6549106-6549128 GCTACCCCAGGCCACTGACTAGG - Intronic
1025993646 7:66514269-66514291 GGTGTCCTGGGCCAGGGACTGGG + Intergenic
1035648473 8:1246837-1246859 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1035648490 8:1246935-1246957 GGTGTTCCTGGCCACCGACATGG - Intergenic
1035648525 8:1247131-1247153 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1035648544 8:1247228-1247250 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1035648620 8:1247624-1247646 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1035648651 8:1247771-1247793 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1035648667 8:1247871-1247893 GGTCTTCCTGGCCACCGACGTGG - Intergenic
1035648701 8:1248069-1248091 GGTCTTCCCGGCCACCGACATGG - Intergenic
1035648728 8:1248216-1248238 GGTCTTCCCGGCCACCGACATGG - Intergenic
1035648738 8:1248265-1248287 GGTCTTCCCGGCCACCGACATGG - Intergenic
1035648749 8:1248314-1248336 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1035648780 8:1248461-1248483 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1035648795 8:1248561-1248583 GGTCTTCCGAGCCACCGACGTGG - Intergenic
1035648803 8:1248610-1248632 GGTCTTCCCGGCCACCGACGTGG - Intergenic
1050322508 9:4467378-4467400 GGTATCAGTGGCCACCTACTGGG - Intergenic
1052691341 9:31820515-31820537 GGTCTCCTGGCCCACCAACTTGG - Intergenic
1056356460 9:85805574-85805596 GGCCTCCCGGGCCGCCGGCTCGG - Intergenic
1060842570 9:126805242-126805264 GGTATGCCGGTCCACGGAATGGG - Intronic
1186212670 X:7266423-7266445 GGAATCCCAGGCCACAAACTGGG - Intronic
1199846507 X:151695590-151695612 GGTATCCAGGGCCAACGAGCTGG + Intronic
1201585651 Y:15558096-15558118 GGAATCCCAGGCCACAAACTGGG - Intergenic