ID: 1148685175

View in Genome Browser
Species Human (GRCh38)
Location 17:49496813-49496835
Sequence CCGGGCCACCGACTCGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685167_1148685175 8 Left 1148685167 17:49496782-49496804 CCGGACGCCTCGGATTCTGTAGC 0: 1
1: 0
2: 0
3: 3
4: 19
Right 1148685175 17:49496813-49496835 CCGGGCCACCGACTCGGCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 26
1148685169_1148685175 1 Left 1148685169 17:49496789-49496811 CCTCGGATTCTGTAGCGCGGTAT 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1148685175 17:49496813-49496835 CCGGGCCACCGACTCGGCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 26
1148685163_1148685175 27 Left 1148685163 17:49496763-49496785 CCTAACGAGACGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1148685175 17:49496813-49496835 CCGGGCCACCGACTCGGCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 26
1148685166_1148685175 9 Left 1148685166 17:49496781-49496803 CCCGGACGCCTCGGATTCTGTAG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1148685175 17:49496813-49496835 CCGGGCCACCGACTCGGCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685175 Original CRISPR CCGGGCCACCGACTCGGCAA AGG Intronic
916479599 1:165202854-165202876 CCAGGCCACTCACTTGGCAAAGG - Exonic
920129525 1:203721124-203721146 CTGGGCCATCGACAGGGCAAAGG + Intronic
922025945 1:221748935-221748957 CCGGGCCACCGGCTAGGGATGGG - Intergenic
1066442223 10:35449658-35449680 CCGGCCCCCCTACTCGGCAATGG - Intronic
1070744145 10:78922654-78922676 GCCGGCCACCCACTAGGCAATGG - Intergenic
1076541030 10:131214952-131214974 CAGGGCCCCCGACACGGCCATGG - Intronic
1077218728 11:1405876-1405898 CTGGGCCAATCACTCGGCAAGGG - Intronic
1077459308 11:2700695-2700717 CCAGGCCACCCACCTGGCAAAGG + Intronic
1077887353 11:6395618-6395640 CCGTGCCACAGACTCAGCAGGGG + Exonic
1143490344 17:7282217-7282239 CCGCGCCGCCTACTAGGCAAGGG - Intronic
1146935144 17:36808516-36808538 CCGGGCCAGCGCCGCGGGAATGG - Intergenic
1148685175 17:49496813-49496835 CCGGGCCACCGACTCGGCAAAGG + Intronic
1150416405 17:64992342-64992364 CCTGGCCACCCACTCTCCAAGGG + Intergenic
1152523415 17:80873571-80873593 CCGGGCAACAGCCTCTGCAAAGG - Intronic
1159743967 18:72209308-72209330 CCGGCCCACCGGCGCTGCAATGG + Intergenic
1160832282 19:1109542-1109564 CAGCGCCAGCGACTTGGCAAAGG + Exonic
932209603 2:69915645-69915667 CCCGGCCACCCACTCGTGAAGGG - Intronic
1176053150 20:63131142-63131164 CCGGGCCACCCACACAGCAAGGG + Intergenic
1179586511 21:42376927-42376949 CAGGGCCACCGACTCCCCTAAGG + Intronic
1182472293 22:30556014-30556036 CCGGGCCAACGGCTCGGCGGGGG - Exonic
1184604119 22:45562558-45562580 CCTGGCCACTGTCTGGGCAAGGG + Intronic
950406869 3:12810309-12810331 GCCGGCCACCGCCTCGGTAAGGG + Exonic
966945382 3:184773884-184773906 CCGGGACAGTGACTCGCCAAAGG - Intergenic
981542576 4:145861021-145861043 CCGGGTCACCCACTGGGCAAGGG - Intronic
986527887 5:8700414-8700436 CCAGGCCACAGGCTTGGCAAGGG + Intergenic
996487717 5:124056448-124056470 CATGGCCAACAACTCGGCAATGG + Intergenic
1002050570 5:176568414-176568436 CAGGGCCACAGGCTTGGCAAGGG + Intronic
1002107458 5:176887216-176887238 CTGGGCCACAGTCTCGGGAATGG + Exonic
1006470010 6:34223475-34223497 CCGGGCCACGAAGTCGGCATGGG + Intergenic
1027133641 7:75609288-75609310 CCTTGCCACAGACTCGGCAATGG - Intronic
1032587843 7:133164049-133164071 CCGGGCCACAGACTCGTCCATGG - Intergenic
1060811336 9:126612942-126612964 CCGGGCACCCGACCCGCCAAAGG + Intergenic