ID: 1148685354

View in Genome Browser
Species Human (GRCh38)
Location 17:49497577-49497599
Sequence GCCGCGCGCCGAGGCGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 7, 2: 3, 3: 43, 4: 368}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148685354_1148685360 -10 Left 1148685354 17:49497577-49497599 CCGCCTCCGCCTCGGCGCGCGGC 0: 1
1: 7
2: 3
3: 43
4: 368
Right 1148685360 17:49497590-49497612 GGCGCGCGGCTGCTCGGTCTGGG 0: 1
1: 0
2: 4
3: 3
4: 105
1148685354_1148685363 21 Left 1148685354 17:49497577-49497599 CCGCCTCCGCCTCGGCGCGCGGC 0: 1
1: 7
2: 3
3: 43
4: 368
Right 1148685363 17:49497621-49497643 GCGCGGTCCGAGTTTCTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1148685354_1148685362 4 Left 1148685354 17:49497577-49497599 CCGCCTCCGCCTCGGCGCGCGGC 0: 1
1: 7
2: 3
3: 43
4: 368
Right 1148685362 17:49497604-49497626 CGGTCTGGGATGGCTGTGCGCGG 0: 1
1: 0
2: 2
3: 8
4: 116
1148685354_1148685366 28 Left 1148685354 17:49497577-49497599 CCGCCTCCGCCTCGGCGCGCGGC 0: 1
1: 7
2: 3
3: 43
4: 368
Right 1148685366 17:49497628-49497650 CCGAGTTTCTTCCTGGGCCGCGG 0: 1
1: 0
2: 0
3: 14
4: 102
1148685354_1148685361 -6 Left 1148685354 17:49497577-49497599 CCGCCTCCGCCTCGGCGCGCGGC 0: 1
1: 7
2: 3
3: 43
4: 368
Right 1148685361 17:49497594-49497616 CGCGGCTGCTCGGTCTGGGATGG 0: 1
1: 0
2: 0
3: 11
4: 97
1148685354_1148685364 22 Left 1148685354 17:49497577-49497599 CCGCCTCCGCCTCGGCGCGCGGC 0: 1
1: 7
2: 3
3: 43
4: 368
Right 1148685364 17:49497622-49497644 CGCGGTCCGAGTTTCTTCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148685354 Original CRISPR GCCGCGCGCCGAGGCGGAGG CGG (reversed) Intronic
900087270 1:904534-904556 GCCGCGTTCGGAGGAGGAGGCGG - Intergenic
900087302 1:904654-904676 GCCGCGTTCGGAGGAGGAGGAGG - Intergenic
900180199 1:1307897-1307919 GGCGGGCGCCGAGGCGGCGCGGG - Exonic
900189276 1:1346431-1346453 GCCTTGGGCCGAGGCAGAGGAGG - Intronic
900216048 1:1482205-1482227 GGCGCGCGCCAAGGCCGAGCGGG + Exonic
900223168 1:1520208-1520230 GGCGCGCGCCAAGGCCGAGCGGG + Exonic
900349400 1:2227675-2227697 GGCGCGGGCGGAGGCGGAGGCGG - Intergenic
900386371 1:2412759-2412781 CCCGCGAGCCGAGGTGGGGGCGG + Intronic
900512970 1:3069045-3069067 ATCCCGCGCCGAGGCGGCGGCGG + Intergenic
900780445 1:4614365-4614387 GCCCCGAGCCGAGGCCAAGGGGG + Intergenic
900782307 1:4626149-4626171 GCCGGGGCCCGAGGAGGAGGTGG + Intergenic
901641193 1:10694029-10694051 GGCGGGCGCCGAGGCCGCGGCGG + Intronic
902323569 1:15684304-15684326 GCTGTGCGCCGCGGCGGCGGCGG - Intergenic
902366209 1:15975926-15975948 CCCGGGAGCCGGGGCGGAGGCGG - Intronic
902690554 1:18108011-18108033 GCCACTGGCCGAGGCGGTGGCGG - Exonic
903121206 1:21218021-21218043 GCCAGGCCCCGAGACGGAGGTGG - Intronic
903875758 1:26472304-26472326 GCGGCGCGCCGAGGGGGTGGGGG - Intergenic
903936717 1:26900415-26900437 GGTGCCCGGCGAGGCGGAGGAGG - Exonic
904467791 1:30718510-30718532 GCCGGGGGCGGAGGCGGAGACGG - Intronic
904641996 1:31938109-31938131 GTCGCGCGCCGAGGCTGGGGGGG - Exonic
904724920 1:32539784-32539806 GCCGGGCGGCGAGGCGGGCGCGG - Intronic
904782943 1:32964415-32964437 GCCGGCCGCCGAGGCCGAGGCGG - Exonic
905584400 1:39105551-39105573 CCCGCGCGCTGAGGCGGCGGCGG - Intronic
907010640 1:50959907-50959929 GCCGGGCGCCGAGGGGCTGGCGG + Exonic
907126685 1:52056494-52056516 GCGGCGAGCGGGGGCGGAGGCGG + Intronic
907541011 1:55215371-55215393 GCCGCCCGGGGAGGAGGAGGCGG - Intergenic
909392946 1:75136520-75136542 TCCCCGCGCCGAGGCTGGGGCGG + Intronic
910251424 1:85201657-85201679 CGCGCTCGCGGAGGCGGAGGCGG + Intergenic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
913528031 1:119712539-119712561 GCCCCGCGCGGAGGCGGTTGGGG - Intronic
914677877 1:149917789-149917811 GCCGCGGGCGGAGGCGGCAGCGG + Exonic
914694707 1:150067018-150067040 TCAGAGCGCCGAGGCGGGGGCGG + Intergenic
914758265 1:150579017-150579039 GCCGCCAGCAGAGGAGGAGGAGG - Exonic
915165492 1:153945947-153945969 AGGGCGCGCCGAGGGGGAGGAGG + Intronic
916548311 1:165827535-165827557 GCTATTCGCCGAGGCGGAGGCGG - Exonic
916890107 1:169106113-169106135 GGCGCGGGGCGAGGAGGAGGCGG - Intronic
917141807 1:171842131-171842153 GGCGCGCACCGAGGGGGTGGGGG - Intronic
917565339 1:176207076-176207098 GACGCCCGCCGAGCCGGAGGTGG + Exonic
919103545 1:193122164-193122186 GCGGCGCCCCGAGCCGGCGGAGG + Exonic
919811759 1:201413085-201413107 GCTGCACGCCAAGGTGGAGGTGG - Exonic
919991458 1:202710541-202710563 GGCGGGGACCGAGGCGGAGGAGG + Intergenic
920029197 1:203026494-203026516 GCCGCGCGCTTGGGCGGCGGAGG + Intronic
920184590 1:204152082-204152104 CCCGCGGGCCGGGGCGGGGGCGG - Intergenic
923171677 1:231422330-231422352 GCGGCGCGCGAGGGCGGAGGGGG + Exonic
924561083 1:245156574-245156596 GCCGCGGTCCGAGCCGGGGGAGG - Exonic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1063395705 10:5685183-5685205 CCCGGGCGCCCAGGCCGAGGAGG - Intronic
1063663649 10:8049716-8049738 TCCAGGGGCCGAGGCGGAGGAGG + Intergenic
1063995088 10:11611518-11611540 GCGGCGCGGCGCGGCGGCGGCGG + Intronic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064443057 10:15370890-15370912 GCCTGGCGCGGAGGCGGCGGCGG - Intronic
1065099091 10:22316270-22316292 CCCGCGCGCGGGCGCGGAGGCGG + Exonic
1065099942 10:22322014-22322036 GCGGCGCGCCGGGGCTGAGCGGG - Intronic
1070257616 10:74825487-74825509 GCCCGGAGCCGAGGAGGAGGAGG + Intergenic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1070610088 10:77926860-77926882 GGCGCGCGCGGAGGCTGAGGGGG - Intergenic
1071527150 10:86365452-86365474 GGGGCGCGCCGAGGGGGAGTGGG - Intronic
1072190528 10:93073612-93073634 GCTGAGCTCCGAGGCGGCGGTGG - Intronic
1072190558 10:93073712-93073734 GTTCCGCGCCGAGGCAGAGGCGG - Intronic
1072673141 10:97446265-97446287 CCGGGGCGCCGAGTCGGAGGGGG + Exonic
1072915485 10:99535284-99535306 GCCACGCGGCGCGGCGGCGGCGG - Exonic
1073137974 10:101230082-101230104 TCCACGCGGAGAGGCGGAGGAGG + Intergenic
1073392714 10:103192896-103192918 GCCGCGCTGGGAGGCTGAGGCGG + Intronic
1074618435 10:115093327-115093349 GCCGCGCGCCCAGGAGGGCGGGG - Intergenic
1075048626 10:119165680-119165702 GCCGCGCGTGGAGGAGGAGCCGG + Intergenic
1075207075 10:120457174-120457196 GCCGCGGGCGGGGGCGGAGGCGG - Exonic
1076156728 10:128210761-128210783 GCAACGCGGCGGGGCGGAGGTGG - Intergenic
1076930422 10:133528427-133528449 GCCGCGCGGCGAGGAGGTGCGGG - Intronic
1077106064 11:843141-843163 CCCGCGGGCAGAGGCCGAGGCGG - Intronic
1077916057 11:6612124-6612146 GCCCGGGGCCGAGGCGGCGGAGG + Exonic
1078057417 11:8019278-8019300 GCCCCGAGCGGAGCCGGAGGCGG + Intronic
1079035206 11:17014448-17014470 GGCGCGGGCAGGGGCGGAGGCGG + Intergenic
1079071481 11:17351674-17351696 GCCGCGGGCGGAGGCGAGGGAGG + Intergenic
1079407084 11:20156738-20156760 ACCGCGAGCTGAGGCGGGGGCGG - Intronic
1080802007 11:35618329-35618351 GCGGGGAGCGGAGGCGGAGGAGG + Intergenic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1082817045 11:57515743-57515765 GCTGCGCCCCGAGGTGGGGGCGG + Exonic
1083329614 11:61891466-61891488 GCAGCGGGCGGCGGCGGAGGCGG - Exonic
1083747733 11:64744903-64744925 GCTCCGCGCAGGGGCGGAGGGGG - Intronic
1083890346 11:65592697-65592719 GGAGTGCGCCGAGGCTGAGGCGG + Intronic
1083899778 11:65638086-65638108 GCCCCGCCCCCAGGCGGAGCCGG + Intronic
1084161530 11:67353042-67353064 GCCCCGCGACGAGGAGGAAGCGG - Exonic
1084295847 11:68213150-68213172 GACGCGCCCCGAGGAGGAGCGGG - Exonic
1085047477 11:73362141-73362163 CCTGCGCGCCGAGCCGGACGTGG + Exonic
1085295652 11:75430260-75430282 GCTGCGCGCGGAGGACGAGGCGG - Exonic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1088172907 11:107018097-107018119 GACGCGAGCGGCGGCGGAGGCGG + Exonic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1090202287 11:124865473-124865495 GCAGCGCGCAGAGGCTGTGGAGG + Exonic
1091616488 12:2054011-2054033 GCCGCGCCCCGAGCCGGGCGAGG - Intronic
1092256236 12:6928064-6928086 GCCGGGCGGCGCGGCGGGGGCGG + Intronic
1093462472 12:19419232-19419254 GCTGGGAGCCGAGGAGGAGGAGG - Intronic
1094652478 12:32391191-32391213 AGCGGACGCCGAGGCGGAGGAGG + Intergenic
1096116799 12:49059916-49059938 GCCGCCCGGCGACGCGGATGCGG - Intergenic
1096309217 12:50505326-50505348 GCCGTGCGGCGAGGGGGACGAGG + Intronic
1096700624 12:53380493-53380515 GCCGCCCGCCCCGGGGGAGGGGG + Intronic
1096863834 12:54549599-54549621 GCAGCGCGCGGCGGCGGCGGCGG + Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101144755 12:101830727-101830749 GCGGCTCGCTGAGGCGGCGGCGG - Exonic
1102157497 12:110742783-110742805 GCCACGAGCAGAGGCGGTGGTGG + Exonic
1102247145 12:111362793-111362815 GCCCGGCGGCGAGGCGGTGGTGG + Exonic
1102310739 12:111842553-111842575 GCCGCCCGCCGAAGCAGAGCCGG + Intronic
1102687667 12:114736882-114736904 CCCGCGAGGGGAGGCGGAGGCGG + Intergenic
1103363860 12:120368912-120368934 GCCGGGCGCCAGGGCGCAGGGGG + Intronic
1105538959 13:21298116-21298138 GCCGCGCCCAGACCCGGAGGCGG + Intergenic
1106157526 13:27171858-27171880 GCCCTGCGCCGGGGCGGAGCCGG - Exonic
1106597791 13:31161597-31161619 ACCGAGACCCGAGGCGGAGGCGG - Exonic
1106956404 13:34942890-34942912 GCCGCTGGCGGAGGCGGCGGGGG + Exonic
1107008760 13:35646316-35646338 GCAGAGCTCCGAGGCGGATGTGG - Exonic
1110596575 13:77326722-77326744 GCCGAGCCCCGAGGAGGCGGCGG + Intronic
1110706022 13:78602488-78602510 GGCGCGGGCCGAGGCGCTGGCGG - Exonic
1110775660 13:79405846-79405868 GCGGCGCGCGGAGGAGGGGGCGG - Exonic
1112402081 13:99086371-99086393 GCCGCGGGAGCAGGCGGAGGCGG - Intronic
1112506957 13:99981258-99981280 GCCAAGCGCCGAGGCCGAGGAGG + Intergenic
1113656103 13:112068506-112068528 GCCGCCCGCAGCGGCGGCGGCGG - Exonic
1114265349 14:21070166-21070188 GTCCCGCGCGGAGGCGGGGGCGG + Intronic
1116835743 14:49767992-49768014 GGCGCGGGCAGAGGCGGCGGCGG + Exonic
1117545858 14:56794588-56794610 TCCGCGCTCAGAGGCGGGGGTGG - Intergenic
1117974206 14:61281357-61281379 GCAGCGCACCTGGGCGGAGGCGG - Exonic
1118600712 14:67469987-67470009 GCCACGCTCCCAGGCAGAGGGGG - Intronic
1119480584 14:74955471-74955493 GCGGGGCGCCGAGGGGCAGGCGG + Exonic
1119789862 14:77340520-77340542 GCTGGGCCCCCAGGCGGAGGAGG - Exonic
1122130795 14:99603833-99603855 GCGGCGCGCCGAGGGCGAGAAGG - Exonic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122635397 14:103127339-103127361 GCGGCGCGGCGTGGCGGAGGCGG + Exonic
1122688531 14:103521155-103521177 CCCTCGCGGCGAGGAGGAGGAGG - Intronic
1122947842 14:105021292-105021314 GCCGGGCGCAGGGGCGGGGGCGG - Intergenic
1123037996 14:105479081-105479103 GCCGAGCCCCGGGGCGGGGGCGG - Intronic
1123041294 14:105491324-105491346 GCCCCGGGCCGCGGCGGAGGCGG + Exonic
1123051736 14:105547316-105547338 GCAGCAGGCCGAGGCTGAGGGGG + Intergenic
1123077150 14:105673019-105673041 GCTGCAGGCCGAGGCTGAGGGGG + Intergenic
1123495248 15:20817129-20817151 GCCGCAGGCTGTGGCGGAGGGGG + Intergenic
1123551737 15:21386222-21386244 GCCGCAGGCTGTGGCGGAGGGGG + Intergenic
1124555284 15:30719500-30719522 GCCCAGCGCCGTGGAGGAGGAGG - Intronic
1124922290 15:34038844-34038866 GGCGCTCGCGGAGGCCGAGGAGG - Exonic
1127515608 15:59689997-59690019 GGCGAGGGCGGAGGCGGAGGCGG + Intergenic
1127763478 15:62164102-62164124 GCCGCAGGACGAGGCTGAGGCGG + Exonic
1128322030 15:66701162-66701184 GCCGCGCCCGGGGGGGGAGGGGG + Intergenic
1130370587 15:83283391-83283413 GCCGCGGGCGGAGAAGGAGGAGG - Intronic
1130975398 15:88769644-88769666 GCCGGGCGGGGAGGAGGAGGAGG - Intergenic
1131475385 15:92734218-92734240 GGCGCGCGGCGGGGCGGAGGCGG - Intronic
1131517376 15:93088505-93088527 GCCGGGCGTCGAGCGGGAGGCGG + Intronic
1131830562 15:96352246-96352268 GCCGCGACCCGAGCGGGAGGAGG + Intergenic
1202960082 15_KI270727v1_random:113464-113486 GCCGCAGGCTGTGGCGGAGGGGG + Intergenic
1132519806 16:381913-381935 GCCGGGGGCAGAGGCGGAGGCGG - Exonic
1132580862 16:684121-684143 GCCGGGGGCCGTGGCGGAGGAGG - Exonic
1132586001 16:705965-705987 GCCGCGCGCGGGGGCCGGGGCGG - Intronic
1132875684 16:2135915-2135937 GCCGCGCGGGGAGGAGGAGGAGG - Intergenic
1132942245 16:2514056-2514078 TCTGCGGGCCGAGGCGGTGGCGG - Exonic
1133784349 16:8963350-8963372 GCGGCGAGCCGGGGCGGCGGCGG + Exonic
1133924067 16:10180324-10180346 GCCGAGCGCGGCGGCGGAGAAGG - Exonic
1134519301 16:14911438-14911460 GCCGCGCGGGGAGGAGGAGGAGG + Intronic
1134706971 16:16310093-16310115 GCCGCGCGGGGAGGAGGAGGAGG + Intergenic
1134849912 16:17470981-17471003 GACGCGGGCCGAGGCGGAGAGGG + Intergenic
1134960569 16:18402031-18402053 GCCGCGCGGGGAGGAGGAGGAGG - Intergenic
1135382749 16:22008169-22008191 GCGGCGCGCGGGGGCCGAGGGGG + Intronic
1136110882 16:28063185-28063207 GCCGTTCCCCGAGGCGGTGGCGG + Exonic
1136318401 16:29467007-29467029 GCGGCGCCCTGGGGCGGAGGAGG - Exonic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1136432976 16:30206356-30206378 GCGGCGCCCTGGGGCGGAGGAGG - Exonic
1137257623 16:46790052-46790074 GCTGAGCGCGGAGGCGGAGCTGG - Intronic
1138399850 16:56736608-56736630 GCCAGGGGCAGAGGCGGAGGAGG + Intronic
1139465154 16:67150474-67150496 GCCGCGCGGAGATGAGGAGGAGG - Exonic
1140442620 16:74999256-74999278 CCCGCGGGAGGAGGCGGAGGAGG - Exonic
1141972314 16:87492388-87492410 GGCGGGCGCCGGGGCGGGGGCGG + Intergenic
1142221327 16:88856595-88856617 CCCGCGCGGGGAGGAGGAGGGGG - Intronic
1142240283 16:88941638-88941660 GCGGCGCGGGGAGGCGCAGGCGG + Intronic
1143443916 17:6996201-6996223 GACGCGCGGGGAGGCGGAGCTGG + Exonic
1144759773 17:17700708-17700730 GCCGCGCCCCGAGGACGAGAGGG - Intronic
1146053375 17:29568906-29568928 GTGGCGCGCCGAGGGGGACGCGG + Intronic
1146271374 17:31487969-31487991 GCCTCGCGCCGGGGCGGGGCGGG - Intronic
1146339566 17:32007541-32007563 GCCGGGCGCAGTGGCGGCGGTGG - Intergenic
1147157704 17:38552535-38552557 GCTGCGCGTGGAGGTGGAGGCGG - Exonic
1147183989 17:38704056-38704078 GCAGTGCGCCGAAGGGGAGGCGG + Intergenic
1147208169 17:38853815-38853837 GCAGCGCCCAGAGGCGGAAGAGG - Exonic
1147393252 17:40122574-40122596 GCCGGGCACCGAGGCGGAGGAGG - Intronic
1147719818 17:42532151-42532173 GTCGCGCGCCGAGGCTCGGGGGG + Intergenic
1147743153 17:42680005-42680027 GGCGAGCGCCGTGGCGCAGGTGG - Exonic
1148095681 17:45051496-45051518 GCCGGGCGCCGGGGAGGGGGCGG - Intronic
1148493478 17:48037834-48037856 GCCGCGGGGCGGCGCGGAGGCGG - Intronic
1148685354 17:49497577-49497599 GCCGCGCGCCGAGGCGGAGGCGG - Intronic
1148818232 17:50346006-50346028 GGCGCGCGCCGGGGCGGGGCCGG - Intergenic
1148899558 17:50865991-50866013 GCCCCGGGCCCAGGCGGCGGAGG - Intronic
1148936333 17:51166725-51166747 GCCGCGCGTGGTGGGGGAGGAGG + Exonic
1149486340 17:57045896-57045918 GCCGCGTGGGGAGGCGGAGGCGG - Intergenic
1150239828 17:63622583-63622605 GCCGCGGGCGGAGCCGGAGCCGG + Exonic
1150423172 17:65056604-65056626 GGGGCCCGCCGAGGCGGCGGCGG - Exonic
1150830374 17:68512853-68512875 GCGGCGCGCGGGGGCGAAGGCGG - Intronic
1151802040 17:76384490-76384512 GGCGCGGGCCGTGCCGGAGGCGG + Intronic
1152197375 17:78925491-78925513 GGCGCGGGCGGAGGGGGAGGAGG - Intergenic
1152351196 17:79784855-79784877 GCTGGGCGGCGAGGCGGAGTCGG - Exonic
1152392341 17:80010314-80010336 GCCGCGGCCCGAGGCCGGGGAGG - Exonic
1155654328 18:28177037-28177059 GCCGAGCGAAGAGCCGGAGGAGG + Exonic
1156239617 18:35240700-35240722 GCCGGGCGCGGTGGCCGAGGCGG - Intergenic
1156275774 18:35581662-35581684 GCCGGGCGCGGAGGCGGGGGCGG + Intronic
1157251479 18:46099705-46099727 GCCCAGCGCAGAGGCTGAGGAGG - Intronic
1157529555 18:48409574-48409596 GCCGCGCGGCGGGGAGGGGGCGG - Intronic
1158150159 18:54358305-54358327 GTCGCGGGACGCGGCGGAGGGGG + Intronic
1160502879 18:79410985-79411007 GGCGCGGGGCGAGGTGGAGGGGG - Exonic
1160508845 18:79442143-79442165 GCAGCGGGCCGAGGCGGTGGGGG + Intronic
1160722943 19:605229-605251 GCCGCGGGCCCTGACGGAGGGGG + Intronic
1160864348 19:1250437-1250459 GCCGCCCGACGAGACGGTGGAGG + Exonic
1160873143 19:1286005-1286027 CGCGCGCGCGGAGGCGGGGGCGG + Intergenic
1161065872 19:2236993-2237015 GCCGCGGGCCGAGGGTGGGGCGG + Intronic
1161150021 19:2702665-2702687 GCTGCGCGGCGGGGCTGAGGCGG - Exonic
1161264780 19:3359285-3359307 CGCGCGCGCCGCGGCGAAGGTGG + Intergenic
1161400655 19:4065355-4065377 GCCGCGCGCTGCGGCCGGGGCGG - Intronic
1161461938 19:4402824-4402846 GGCCCGCGCCGAGGGGAAGGGGG + Intronic
1161487639 19:4544262-4544284 CCCGGGGGCCGGGGCGGAGGCGG - Exonic
1162022606 19:7874493-7874515 GAAGCGCGCCGAGGGGGATGGGG + Intergenic
1162033162 19:7925940-7925962 GGGGCGCGCCGGGGCGGGGGCGG - Intronic
1162959631 19:14118134-14118156 GCAGCGCTCCGAGGCTCAGGAGG + Intergenic
1163146147 19:15380226-15380248 GCCGCCCCCAGAGGAGGAGGAGG - Exonic
1163509460 19:17726428-17726450 GGCGCGCGGCGAGGATGAGGCGG + Exonic
1163617928 19:18340749-18340771 GCCGGGGGCAGAGGCGGGGGCGG + Intronic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1165236799 19:34428401-34428423 ACCACGAGCCGCGGCGGAGGCGG - Exonic
1165745976 19:38229607-38229629 GCGGCGCCCCGGGCCGGAGGCGG - Intronic
1166547045 19:43639893-43639915 GCGGGGCGCCGAGGCCGGGGCGG + Intergenic
1166734490 19:45076118-45076140 TCCGCGGGCCGAGGGCGAGGAGG + Exonic
1167367688 19:49063748-49063770 CCAGAGCTCCGAGGCGGAGGAGG - Intronic
1167638555 19:50668294-50668316 GCCGCTGGGCGAGGCGGGGGTGG + Exonic
1168064039 19:53909381-53909403 GCCGGGCTCCGGGGCGGGGGCGG + Exonic
1168076347 19:53982598-53982620 GCCGGGGGCGGCGGCGGAGGCGG + Exonic
1168100401 19:54138260-54138282 GCCACGCGGGGAGGCGGCGGCGG - Intronic
1168691596 19:58380835-58380857 CCCGCGCGCGGAGGTGGAGAGGG + Intronic
926980193 2:18560320-18560342 CGCGCGCGCCGAGGAGGCGGCGG - Exonic
929033858 2:37672435-37672457 GACGCGCGACGAGGCGCAAGTGG + Intronic
930872794 2:56184792-56184814 GCGGCGCGCCGAGGCGGAGAAGG + Exonic
931614589 2:64143832-64143854 GCCCCGCTCCCGGGCGGAGGGGG + Intronic
933655243 2:84881221-84881243 GCCCCGCGCCTAGGCGGCAGCGG + Exonic
933791752 2:85888839-85888861 GCCGCGGACCGAGGCAGCGGCGG - Exonic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935971485 2:108534368-108534390 GCCGCGCGGGAAGGCGGGGGAGG - Intronic
937853521 2:126656419-126656441 GCCGGGCCTCCAGGCGGAGGAGG + Intronic
938368840 2:130756263-130756285 GCCGCGCGCCGCGGCCGGGAGGG - Intronic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
939613028 2:144332563-144332585 GACGCGCCCGGAGGCCGAGGCGG - Intronic
941666321 2:168247172-168247194 GCCGGGCGCCGAGGCCGGGCGGG - Intronic
941812638 2:169768924-169768946 GGCGCGCCCCGACCCGGAGGCGG + Intronic
942240832 2:173963799-173963821 GCCGGGCGACGACGAGGAGGAGG - Exonic
942241142 2:173964777-173964799 GCAGCGCGGGGAGGAGGAGGAGG - Intronic
942453565 2:176123085-176123107 GCCGGGCTCGGAGGCAGAGGCGG - Exonic
944831214 2:203535334-203535356 GCAGCGCCCCGCGGCGGCGGCGG + Exonic
945188968 2:207166693-207166715 GCCCCGTGCCCAGGCGGAGGCGG - Intronic
945673887 2:212832796-212832818 GCCGCGTGGCGTGGCGGAAGTGG - Intergenic
947792644 2:232876828-232876850 GGCCCGCGCCCAGGCAGAGGAGG - Intronic
948983973 2:241508805-241508827 GCCGCGCGCCTGGGCGGGCGGGG + Intronic
1169849556 20:10034894-10034916 GGCGGGGGCGGAGGCGGAGGCGG + Intronic
1170756846 20:19212596-19212618 GGCGAGCGGCGAGGAGGAGGAGG + Intergenic
1172702894 20:36863593-36863615 GGGGCGCGGCGAGGCCGAGGGGG - Exonic
1173322285 20:41998863-41998885 GCAGCGCGAGGAGGCCGAGGCGG - Intergenic
1175429455 20:58891475-58891497 CCCTCGAGCCGAGGCCGAGGGGG - Intronic
1175521347 20:59604386-59604408 ACCGCGCGCCGGGGTGGGGGAGG - Intronic
1175715928 20:61253824-61253846 GCAGCGCGCGGAGCTGGAGGAGG + Intronic
1176062692 20:63179156-63179178 GCCGCGGGGCGGGGCGGAGGCGG + Intergenic
1176100287 20:63361500-63361522 ACCGCGCGCCCAGGGGGACGGGG + Intronic
1176132187 20:63500807-63500829 GCCGGGAGCCGAGGGGGAAGGGG - Intergenic
1176178671 20:63739881-63739903 GCCGGGCGCCGAGGCTGCAGCGG - Exonic
1176550155 21:8217346-8217368 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176569083 21:8400381-8400403 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176576997 21:8444616-8444638 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1178334513 21:31731738-31731760 ACCTCGCGCCGCGGCGGAGCGGG + Exonic
1181695902 22:24592740-24592762 GCCGGGAGGCGAGGCGGAGCTGG - Intronic
1182094070 22:27614476-27614498 GGCGGGCGCCGTGGCGGTGGCGG + Intergenic
1183149703 22:36028263-36028285 GCCGCGCACTGAGGAGGCGGCGG - Exonic
1184920233 22:47600689-47600711 GCCGTGCACAGAGGCTGAGGGGG - Intergenic
1184920314 22:47601005-47601027 GCCGTGCACAGAGGCTGAGGGGG - Intergenic
1185427858 22:50783629-50783651 GACGCGGGCCGAGCCGGAAGTGG - Exonic
1203255048 22_KI270733v1_random:133678-133700 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203263104 22_KI270733v1_random:178757-178779 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
950940339 3:16884965-16884987 GCGGCGGCCCGAGGCGGCGGCGG + Intronic
953748716 3:45594082-45594104 AGCCCGCGCCGGGGCGGAGGGGG - Intronic
953925938 3:46982439-46982461 GCCGGGCCCCCAGGGGGAGGGGG - Intronic
955916480 3:63912634-63912656 GCCGCGCCGCGCGGCGGCGGCGG + Exonic
958641509 3:96813424-96813446 ACCTCGCCCCGCGGCGGAGGCGG - Intergenic
962498473 3:135965929-135965951 GCGGCGCGCGGAGGCCGGGGCGG + Intronic
966861006 3:184230760-184230782 CCCGCTGGCCGAGGCCGAGGTGG + Exonic
967055360 3:185825132-185825154 CCCGGGGGCAGAGGCGGAGGCGG + Intergenic
968556403 4:1248380-1248402 GCCGCGCGCTGTGGGGGAAGGGG - Intronic
968701239 4:2059167-2059189 GCCACCCGGCGAGGCGGGGGCGG + Intergenic
969138819 4:5051730-5051752 GCCGCGCGCGGAGCCCGAGGGGG - Exonic
969240376 4:5893114-5893136 GGCGCGCGCCGGGGCGGGGCCGG + Intergenic
970188170 4:13484325-13484347 GCCGCGCGCAGAGGGCGGGGAGG - Exonic
973764250 4:54149338-54149360 GCCGGGCGCCGCGGAGCAGGGGG + Intronic
973820592 4:54658637-54658659 GCCGCGAGCAGAGGCGGCAGCGG - Intronic
975166939 4:71187445-71187467 CCCTCGCTCCAAGGCGGAGGCGG + Intronic
976002164 4:80386466-80386488 GCCCCGCGCCGTGGCGGCAGTGG - Intronic
976246802 4:83012806-83012828 GCCGCGCGACCAGGAGGCGGCGG - Intronic
976431413 4:84966525-84966547 GAGGAGCGCCGAGGCTGAGGCGG - Intergenic
979785684 4:124712798-124712820 GCCGAGCGGCGGGGCGGGGGCGG - Intergenic
984462963 4:180059061-180059083 GCCGAGTGCCGAGGCCGCGGCGG + Intergenic
984845409 4:184104044-184104066 GCAGTGCGCCCAGGCTGAGGAGG + Intronic
985896294 5:2751562-2751584 CCCGCGGGCCGGGGCGGCGGCGG + Exonic
986695785 5:10353653-10353675 GCGGGGCGCCGAGGCGGAAGGGG - Intergenic
986813599 5:11384951-11384973 GCCGCGCGGCGCGGCGTAGGTGG + Exonic
987286789 5:16465485-16465507 GCAGCGGGCCGTCGCGGAGGAGG - Exonic
987340447 5:16935472-16935494 GGCGCGCGCCGGGGCGCGGGCGG - Intronic
988547788 5:32174277-32174299 CCCGAGCTCCAAGGCGGAGGCGG + Exonic
989643187 5:43603156-43603178 GCCGCCCGCCGCCGCGGAGTTGG + Intronic
991731550 5:69594302-69594324 GCCGGGCACGGTGGCGGAGGTGG - Intronic
991807982 5:70449448-70449470 GCCGGGCACGGTGGCGGAGGTGG - Intergenic
991863401 5:71033563-71033585 GCCGGGCACGGTGGCGGAGGTGG + Intergenic
992663711 5:78985331-78985353 GTCCCGCGCCGGGGCGGAGCAGG - Exonic
992828157 5:80569751-80569773 GCCGCTCGGCGAGGCTGAGAAGG + Intronic
995206611 5:109487878-109487900 ACCGGGCGCCGAGGAGCAGGGGG + Intergenic
997485435 5:134226632-134226654 GCCGCGCCCAGAGGTGGGGGTGG - Intergenic
998265476 5:140664808-140664830 CCCGCCCCCCGAGGCGGAAGCGG + Exonic
1001065070 5:168529574-168529596 GGCGGGGGCCGAGGCGGCGGCGG + Exonic
1001640234 5:173238813-173238835 GCCCAGCGCGGAGGCGGAGGCGG - Intergenic
1002352140 5:178590463-178590485 CCCGCGCGGCGAGGGGGCGGGGG + Exonic
1002498884 5:179634491-179634513 CCCGCGCACCGCGGAGGAGGCGG - Intronic
1002502792 5:179658033-179658055 CCCGCGCACCGCGGAGGAGGCGG + Intergenic
1003575834 6:7293545-7293567 GACGTGCGCCTAGGCTGAGGTGG - Intronic
1004044580 6:12012111-12012133 GGCGCGCGCCGCGGCGGGGCGGG - Intronic
1005582947 6:27251070-27251092 GGCCCGCACCGGGGCGGAGGAGG - Exonic
1005755624 6:28923221-28923243 GCCGCTCGAGGAGGCGGTGGAGG - Exonic
1006535667 6:34696846-34696868 GGCGCGGGAGGAGGCGGAGGCGG - Exonic
1007644433 6:43369456-43369478 GCGGCGCGCAGCGGCCGAGGTGG - Intronic
1007701904 6:43770748-43770770 GCCGCCGGCCGGGGAGGAGGTGG - Exonic
1007902063 6:45422094-45422116 GCGGCGCGGCGCGGCGGTGGCGG + Intronic
1010107080 6:72182656-72182678 CCCGCGCACCGAGGCGGGCGCGG + Exonic
1012887256 6:104859847-104859869 GGCGCGAGCAGAGGCGGCGGCGG - Exonic
1013155746 6:107490069-107490091 CCCGCGAGCCGAGCCGGGGGCGG - Exonic
1013507478 6:110814893-110814915 CCCGAGGGGCGAGGCGGAGGGGG - Intronic
1013793682 6:113860422-113860444 GCCGGGCCCGGCGGCGGAGGGGG - Exonic
1015497438 6:133895888-133895910 GCTGAGCGCAAAGGCGGAGGAGG + Intergenic
1016714140 6:147204237-147204259 GCCGCGGAGCGAGGCGGCGGCGG + Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1018903305 6:168061846-168061868 GCCGCACGCGGAGGTGGAGCTGG + Exonic
1019472701 7:1229841-1229863 GCCCCGAGCCGAGGCGGGCGCGG + Intergenic
1019577979 7:1746663-1746685 GCTGCGGGCCGAGGCCGAGAAGG + Exonic
1019681908 7:2355128-2355150 GCCGGCGGCCGAGGCAGAGGCGG + Exonic
1020418126 7:7969162-7969184 CCCCCTCGCCGAGGCGGCGGGGG + Exonic
1021717313 7:23471298-23471320 ACCGCGAGCGCAGGCGGAGGCGG - Intergenic
1021828007 7:24573635-24573657 GCCGCGCGCCGGGCCGGCCGGGG + Intronic
1023418182 7:39950965-39950987 GCCCCGCGCCGGGCAGGAGGCGG + Exonic
1024580010 7:50793532-50793554 GCCGGGGGAGGAGGCGGAGGCGG - Intergenic
1028556784 7:92134122-92134144 GGCGCGCGCCGCAGCTGAGGCGG - Intronic
1029537021 7:101163073-101163095 GCGGCGCGCGCAGGAGGAGGCGG - Exonic
1029896465 7:103989619-103989641 GCGTCGCGCAGAGGCGGCGGCGG - Intergenic
1030033216 7:105388199-105388221 GCCGCGGGCCGAGGAGGCGGAGG - Intronic
1030682662 7:112450138-112450160 GGGGCGCGCCGAGGCAGGGGTGG + Intronic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1031919075 7:127588379-127588401 GCGACGCGCGGAGGCGGCGGCGG + Exonic
1032125222 7:129188702-129188724 GCGGCGCGCTGGGGCGAAGGTGG + Intergenic
1032298777 7:130668334-130668356 CCCGCGCGCAGGGGAGGAGGCGG + Intronic
1034223003 7:149460194-149460216 GCCGCGCGCAGTAGCGGCGGCGG - Intronic
1035683643 8:1507601-1507623 AGTGGGCGCCGAGGCGGAGGAGG + Intronic
1036134987 8:6152578-6152600 GGTGGGCGCCGAGGCCGAGGAGG - Intergenic
1036645408 8:10609138-10609160 GCTGGGCGAGGAGGCGGAGGGGG - Exonic
1037273722 8:17156483-17156505 GCTGCGAGCGGAGGCCGAGGAGG - Exonic
1037882318 8:22579235-22579257 GCCGCGCGGAGAGGCGCAGGTGG - Exonic
1038035410 8:23682631-23682653 GCCCCGCGCCGCGCCGGAGGAGG - Exonic
1038151062 8:24942515-24942537 GCCGCGCCCGGAGGAGGAGGCGG - Intergenic
1038265904 8:26039958-26039980 GCGGCGCGCCAAGGCGGGGCTGG + Intronic
1038326525 8:26576990-26577012 GCAGCCCGCCGAGGCCGATGTGG - Intronic
1038566262 8:28622535-28622557 GCCGGGAGCCGACGCGGAGGCGG + Intronic
1038632776 8:29262480-29262502 GCCGCGGGCCAAGGCGGTGCAGG + Intronic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1039484306 8:37899262-37899284 GCTGCGCTCCGACACGGAGGTGG + Exonic
1039554954 8:38468684-38468706 GCAGGGGGCGGAGGCGGAGGAGG - Intronic
1039889435 8:41674113-41674135 GCCCCGAGCGGAGGCTGAGGGGG - Intronic
1041449961 8:57995168-57995190 GCCGCGCTGCGGAGCGGAGGTGG + Intronic
1043053279 8:75407535-75407557 TGCGCGCGCCGAGGCGGTGGCGG + Intergenic
1044712827 8:95073501-95073523 GCAGCGGGGCGAGGCGGGGGCGG - Intronic
1045443641 8:102239080-102239102 GCGGAGCCCCGAGGCGGGGGAGG - Exonic
1047739306 8:127794312-127794334 GCCGCGCGCGGAGGCGGGGCGGG - Intergenic
1048345535 8:133572068-133572090 GCCGCGCGCAGGGGAGGCGGTGG - Intergenic
1048484235 8:134832208-134832230 GCCGCGCGCCATGACGGACGCGG - Intergenic
1048553970 8:135457606-135457628 GGCGCGGGCCGAGGAGGAGCGGG - Exonic
1049109799 8:140635654-140635676 GCGGCGGGCGGAGGCGGCGGCGG + Intergenic
1049194757 8:141308832-141308854 GCCACGGGCAGGGGCGGAGGGGG - Intergenic
1049405260 8:142449564-142449586 GCGGCGCGGGGAGGAGGAGGAGG - Exonic
1049452470 8:142669673-142669695 GCCGCGCGCTCAGGCCGCGGGGG + Intronic
1049639301 8:143707386-143707408 GCGGCGCGCGGAGCGGGAGGCGG - Exonic
1049664202 8:143835783-143835805 GCGGCGCGGCCTGGCGGAGGGGG - Intronic
1049682062 8:143923673-143923695 GCTGCGCGGCGAGGCGGAGGCGG - Exonic
1049682202 8:143924429-143924451 GCAGCGGGCCGAGGCGGAGCGGG - Exonic
1049682276 8:143924756-143924778 GCTGCGGGCCGAGACGGAGCAGG - Exonic
1049762751 8:144338381-144338403 CCCGCGCGGCGCGGCCGAGGGGG - Intergenic
1051418807 9:16870797-16870819 GGCGGGCGGGGAGGCGGAGGCGG - Intronic
1051425159 9:16924890-16924912 GCCACACGCCGAGGCTGAGGAGG + Intergenic
1053409121 9:37904209-37904231 GCCGCGGGCCGAGGGAGGGGAGG - Intronic
1053434945 9:38068481-38068503 GCAGGACGCCGAGGCGGCGGAGG + Exonic
1054798566 9:69325189-69325211 GACGGGCTCCGAGGCCGAGGGGG - Intronic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1055611847 9:78031823-78031845 GGCGGGGGCGGAGGCGGAGGCGG - Intergenic
1057207823 9:93184142-93184164 CCCGCGCGCCGGGTCGGAGCCGG + Intergenic
1057600125 9:96450447-96450469 GAGGCGCGACGAGGCGGCGGCGG + Exonic
1060599588 9:124869150-124869172 GCTGCGCGCGGAGGCGGTGGAGG + Exonic
1060700601 9:125746938-125746960 GCGGCGGGCGGCGGCGGAGGAGG - Intergenic
1060700686 9:125747189-125747211 GCCGGGCTCCGCGGCGGTGGCGG - Intergenic
1061449565 9:130660946-130660968 GCGGAGCGCCGAGGGGAAGGAGG - Intergenic
1061450408 9:130664375-130664397 GACGCGGGTGGAGGCGGAGGCGG - Intergenic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1061975846 9:134067774-134067796 GCCGCGCACAAAGGCGGCGGCGG + Intronic
1062022761 9:134326945-134326967 GCTGGGCGCCGGGGCGCAGGCGG - Intronic
1062461953 9:136665919-136665941 GCCGCGCGCGGAGCTGGGGGCGG + Intronic
1062630776 9:137462146-137462168 GCCACCCGCGGCGGCGGAGGCGG - Intronic
1062659099 9:137619084-137619106 GCGGCGGGCAGCGGCGGAGGCGG + Intronic
1203781947 EBV:105685-105707 ACCGCGCGTCGAGGCCCAGGAGG + Intergenic
1203471448 Un_GL000220v1:116818-116840 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203479269 Un_GL000220v1:160790-160812 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1186466075 X:9785851-9785873 CGCGCGCCCCGAGACGGAGGAGG + Intronic
1186768057 X:12791455-12791477 GGGGCGCGCGGCGGCGGAGGAGG - Exonic
1187172996 X:16869996-16870018 GGCGCGCGCCGGGGCCGCGGGGG - Intronic
1187173128 X:16870537-16870559 GCCGGCCGCGGAGGCGGATGGGG + Intergenic
1187547615 X:20267955-20267977 GCCGTGGGCGGAGGAGGAGGAGG + Intergenic
1189002794 X:36963746-36963768 CCCGCGGCCCGCGGCGGAGGTGG - Intergenic
1189821495 X:44873418-44873440 GCCGCCGCCCGCGGCGGAGGAGG + Intronic
1189821497 X:44873421-44873443 GCCGCCCGCGGCGGAGGAGGAGG + Intronic
1190062222 X:47218929-47218951 GCCGCCGGCTGAGGAGGAGGAGG - Intronic
1190266925 X:48832164-48832186 GGCGCGGGCCGAGGCGCAGGAGG - Exonic
1190385489 X:49879491-49879513 GCCGCCAGTGGAGGCGGAGGAGG + Intergenic
1194383608 X:93225037-93225059 ACCGCAGGCGGAGGCGGAGGGGG + Intergenic
1197785230 X:130191528-130191550 GCCGGGTGCAGAGGCCGAGGTGG + Intergenic
1198158595 X:133985693-133985715 GCCGCGCGGCCAGGGGGCGGTGG + Intronic
1198942215 X:141968324-141968346 GCCGGGTGCAGAGGCCGAGGCGG - Intergenic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic