ID: 1148686766

View in Genome Browser
Species Human (GRCh38)
Location 17:49505454-49505476
Sequence CAGAATAAGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 966
Summary {0: 1, 1: 0, 2: 6, 3: 82, 4: 877}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148686766_1148686772 25 Left 1148686766 17:49505454-49505476 CCAGCCTCCTTCTCCTTATTCTG 0: 1
1: 0
2: 6
3: 82
4: 877
Right 1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148686766 Original CRISPR CAGAATAAGGAGAAGGAGGC TGG (reversed) Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907618317 1:55948161-55948183 CACAGTAAGGAAATGGAGGCAGG - Intergenic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912843149 1:113057140-113057162 CAGAACAAGAAGAACCAGGCAGG - Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071120705 10:82274352-82274374 CAGAATTAGAAGAAGGTTGCAGG - Intronic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1081057206 11:38424756-38424778 CAGAATAAGGTGACGTAAGCTGG + Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083310657 11:61781950-61781972 CAGAATAAGGATCAGGAATCAGG + Intronic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG + Intronic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1105249483 13:18685074-18685096 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120451767 14:84677423-84677445 CATAATAAGCAGAATGATGCTGG - Intergenic
1120620361 14:86755759-86755781 CAGCATAAGGGGTAGAAGGCAGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1139084633 16:63569726-63569748 GGGAATAAAGAAAAGGAGGCAGG + Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG + Intergenic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160254970 18:77240449-77240471 CAAAATAACTAGAAGGGGGCTGG - Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
929951509 2:46413453-46413475 GGTAATAAGGAAAAGGAGGCTGG + Intergenic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG + Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939103605 2:137924544-137924566 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946598715 2:221335476-221335498 CAGCATAAGGAGACGGTAGCCGG - Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1171486390 20:25489460-25489482 GGGAGTAAGGAGAAGGAGGGGGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176456333 21:6915581-6915603 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176834507 21:13780641-13780663 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179745913 21:43444194-43444216 CAGCATATGGAGAACGCGGCAGG + Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954502554 3:51032486-51032508 CACAATAAGCATAAGAAGGCTGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969289925 4:6232120-6232142 CCAAATAAGGAGAAGGCCGCAGG - Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970122903 4:12777265-12777287 TGGACTAAGGTGAAGGAGGCAGG - Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
992959407 5:81943590-81943612 TAGAATAAGGAGAAGAACGTTGG + Intergenic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
998188197 5:139999228-139999250 CGGCATAAGGGGAATGAGGCAGG - Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG + Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006339452 6:33438674-33438696 CAGAATCAGGTGTTGGAGGCTGG - Intronic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008675291 6:53812392-53812414 CAGAATTTGAAGAAAGAGGCCGG + Intronic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021934928 7:25620895-25620917 CAGAATAAGGTGGTGGTGGCTGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031267039 7:119594103-119594125 CAGAATAAGAAGAAGAAGTTGGG + Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG + Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049495186 8:142926900-142926922 CAGAAGGAGGAGACGGATGCAGG - Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056131577 9:83592481-83592503 CAAAATTAGTAGAAGTAGGCCGG + Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059179596 9:112199385-112199407 TAGAATAAGTAGGAGTAGGCTGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG + Intergenic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic