ID: 1148686772

View in Genome Browser
Species Human (GRCh38)
Location 17:49505502-49505524
Sequence ACATGAGTGAAGAATGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 239}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148686765_1148686772 26 Left 1148686765 17:49505453-49505475 CCCAGCCTCCTTCTCCTTATTCT 0: 1
1: 1
2: 10
3: 143
4: 1059
Right 1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 239
1148686771_1148686772 -8 Left 1148686771 17:49505487-49505509 CCAGTAATTAAGAAAACATGAGT 0: 1
1: 0
2: 1
3: 22
4: 230
Right 1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 239
1148686769_1148686772 18 Left 1148686769 17:49505461-49505483 CCTTCTCCTTATTCTGGAGTGCA 0: 1
1: 0
2: 0
3: 14
4: 184
Right 1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 239
1148686766_1148686772 25 Left 1148686766 17:49505454-49505476 CCAGCCTCCTTCTCCTTATTCTG 0: 1
1: 0
2: 6
3: 82
4: 877
Right 1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 239
1148686770_1148686772 12 Left 1148686770 17:49505467-49505489 CCTTATTCTGGAGTGCACATCCA 0: 1
1: 0
2: 0
3: 8
4: 299
Right 1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 239
1148686768_1148686772 21 Left 1148686768 17:49505458-49505480 CCTCCTTCTCCTTATTCTGGAGT 0: 1
1: 0
2: 3
3: 39
4: 323
Right 1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148686772 Original CRISPR ACATGAGTGAAGAATGAGCT TGG Intronic
900095180 1:937328-937350 CCATGAGTGAGGAGTGAGCATGG + Intronic
900714936 1:4138142-4138164 ACAGCAGTGGGGAATGAGCTGGG - Intergenic
901539287 1:9904952-9904974 AGATGAGGGAAGCATCAGCTAGG - Intronic
902635101 1:17729749-17729771 ACATGACTCAGGGATGAGCTGGG + Intergenic
902684164 1:18064981-18065003 ACATGAGAGAAGGCTGACCTGGG + Intergenic
903308747 1:22435294-22435316 ATATTAGTGAAGGATAAGCTGGG - Intergenic
903726945 1:25455287-25455309 ACATTTTTGAAAAATGAGCTTGG + Intronic
905210046 1:36367711-36367733 ACATGAGGACAGACTGAGCTGGG - Intronic
908520230 1:64934497-64934519 ACAACAGTGAAGGAAGAGCTTGG + Intronic
911629139 1:100162697-100162719 TCATGAGTGAAGAATTTTCTGGG - Intronic
912528009 1:110299244-110299266 ACAGGAGTGAGGAATGAGCCTGG + Intergenic
913049063 1:115099695-115099717 ACATGAGTGAAGAAAGAGAGGGG + Intergenic
914429309 1:147605746-147605768 CCAGAAGTTAAGAATGAGCTAGG + Intronic
915202397 1:154241575-154241597 GCATTAGTGAGGAATGACCTGGG - Intronic
915715076 1:157937810-157937832 TTCTGAATGAAGAATGAGCTTGG + Intergenic
915926406 1:160023664-160023686 TCCTGAGTTAGGAATGAGCTTGG - Intergenic
917521279 1:175750205-175750227 GCAAGAGTGGAGAATGAGTTGGG + Intergenic
919119146 1:193317115-193317137 TCCTGAGTCACGAATGAGCTCGG + Intergenic
919505285 1:198390761-198390783 AAATGTGTGAAGAATGGGATGGG + Intergenic
920358321 1:205392757-205392779 AAAGGAGAGAAGAATGAGGTGGG + Intronic
920382352 1:205542621-205542643 ACAAGAGTGTAGACTAAGCTGGG - Intergenic
923176752 1:231474339-231474361 ACATGACTGAAGCAGGAGCCGGG + Intergenic
923570594 1:235110175-235110197 ACTGGAGTGCAGTATGAGCTGGG - Exonic
924471811 1:244349396-244349418 ACATAAGTGAACTATGATCTAGG + Intergenic
1064145519 10:12823493-12823515 GCATGAGGGAAGGAAGAGCTGGG + Intronic
1064166299 10:12989190-12989212 CCTTGAGTGAACATTGAGCTTGG - Intronic
1065626497 10:27634920-27634942 ACAAGAGTGTAGAATGTGGTGGG + Intergenic
1066284876 10:33955870-33955892 ACTTGAGTGAGAAATGAACTTGG - Intergenic
1067018087 10:42772397-42772419 AGACAAGTGAAGAATGAGCAAGG - Intergenic
1069987177 10:72292391-72292413 GCAGGAGTGATGGATGAGCTAGG + Intergenic
1070185919 10:74062489-74062511 ACAAAAGTAAAGATTGAGCTGGG - Intronic
1072098602 10:92207276-92207298 ACATGAAAGAAAAATGGGCTGGG - Intronic
1072634356 10:97168053-97168075 ACATGAATACAGAATGAGCTGGG + Intronic
1075683721 10:124349835-124349857 ACATAAGAGGAGAAGGAGCTGGG - Intergenic
1077730592 11:4725086-4725108 ACATGGCTGAAGAAGGAGCAAGG - Intronic
1079591386 11:22187406-22187428 AGGTCAGTGAAGAATGATCTTGG + Intergenic
1081203566 11:40248252-40248274 ACATGAATGAATAAAGTGCTGGG - Intronic
1081683801 11:45027306-45027328 ACATGAGTGATGGATGCCCTCGG + Intergenic
1086191455 11:84084200-84084222 TCATGAGGTAAGAAGGAGCTGGG + Intronic
1087169100 11:95032274-95032296 ACAACAGAGCAGAATGAGCTGGG + Intergenic
1087369366 11:97262580-97262602 ACAGAAGTGAAGAGTGAGATGGG - Intergenic
1087455582 11:98381840-98381862 AAAAGAGTGAAGAAAGAGATAGG + Intergenic
1089744581 11:120607789-120607811 AGATGAGAGAGGAAAGAGCTGGG + Intronic
1089780071 11:120867510-120867532 CCAAGAGTGAAGAAAGAGCAGGG - Intronic
1090274630 11:125410689-125410711 ACATGAGTGCCAAATGAACTGGG + Intronic
1092667022 12:10813144-10813166 ACATGAGTGATGAATGAACTGGG - Intergenic
1093141177 12:15512019-15512041 AAATGGGTGATTAATGAGCTAGG + Intronic
1095927456 12:47593029-47593051 ACAGGAGTGAAGAAAGAATTTGG - Intergenic
1096007870 12:48186479-48186501 ATTTGAGAGCAGAATGAGCTAGG + Intergenic
1104166169 12:126231832-126231854 ACATGAGTGAACAAGGAAATGGG - Intergenic
1105425954 13:20295358-20295380 AAATAAGTGAAAAATGGGCTGGG - Intergenic
1106004209 13:25753337-25753359 ACATGAGTCAGCACTGAGCTGGG - Intronic
1106849014 13:33768361-33768383 ACATGAGTCAAAGATGAGCTTGG + Intergenic
1108377993 13:49830938-49830960 ACTTGAGAGAAGGAAGAGCTGGG - Intergenic
1108761155 13:53566827-53566849 ACATGAATGAAAAATCAGCAGGG + Intergenic
1109070846 13:57765439-57765461 ACATGTGTGAAGAAGAAACTTGG + Intergenic
1109088459 13:58007600-58007622 AAAAGAGTGAAAAACGAGCTTGG + Intergenic
1110594206 13:77300930-77300952 GCATGAGTAAGGACTGAGCTTGG + Intronic
1110651921 13:77951846-77951868 ACTTGAGTAAAGAATGGGATTGG - Intergenic
1111519321 13:89379436-89379458 ACAGGAGTGAAGAAACTGCTGGG + Intergenic
1112286423 13:98108451-98108473 ACGTGAGTGAGGGCTGAGCTTGG - Intergenic
1112306658 13:98280413-98280435 ACATGAGGAAAGAGTGAGCCTGG - Intronic
1113718528 13:112533362-112533384 ACATGAGAGATGCATGGGCTGGG - Intronic
1115067344 14:29280137-29280159 ATATCAGTGAAGAATTAACTTGG - Intergenic
1115536200 14:34375772-34375794 ACATCAGTCAAGAATGATCATGG + Intronic
1119747346 14:77053578-77053600 AAATGAGTGAAAGATAAGCTAGG + Intergenic
1120222115 14:81746317-81746339 ACATAAGAGAAGACTGAGGTTGG + Intergenic
1121587360 14:95071319-95071341 ACATGAAGGAGGACTGAGCTGGG - Intergenic
1121712254 14:96047431-96047453 ACCTCAGTGTAGAAAGAGCTGGG - Intronic
1123462039 15:20481894-20481916 ACATGAGTGTCTAAGGAGCTAGG + Intergenic
1123656017 15:22518494-22518516 ACATGAGTGTCTAAGGAGCTAGG - Intergenic
1124272725 15:28297879-28297901 ACATGAGTGTCTAAGGAGCTAGG + Intronic
1124309927 15:28613667-28613689 ACATGAGTGTCTAAGGAGCTAGG - Intergenic
1127991905 15:64125482-64125504 AAAGCAGTGAAGAATGAGCTGGG + Intronic
1129026917 15:72584879-72584901 ACAGGAGTGCAGAGTGAACTAGG + Exonic
1131311509 15:91294872-91294894 ACCTGAGTGATGGATGAGATGGG - Exonic
1134405518 16:13955248-13955270 ACATTAGTGAAGAAACAGATGGG + Intergenic
1134880859 16:17744794-17744816 AGATGAGAGAAGAGTGAGTTAGG + Intergenic
1135302715 16:21344914-21344936 ACATAAGTGAAGAATTAGGCTGG + Intergenic
1135836648 16:25831774-25831796 ACATGAGTGAAGATTTGGTTAGG + Intronic
1136077006 16:27824087-27824109 CCCAGAGTGAAGCATGAGCTTGG - Intronic
1136221585 16:28832886-28832908 AGGTGAGAGAAGAGTGAGCTGGG + Exonic
1137447620 16:48541422-48541444 ACATGATTGAAGGACAAGCTTGG + Exonic
1138735889 16:59249415-59249437 ACACGGGTGAAGGAGGAGCTGGG - Intergenic
1145052337 17:19672688-19672710 ATATCAGTGAAGAATGGGCTTGG + Intronic
1147045819 17:37751407-37751429 ACATCCGTGAAAAATGAGATTGG + Intergenic
1148686772 17:49505502-49505524 ACATGAGTGAAGAATGAGCTTGG + Intronic
1150005802 17:61468291-61468313 AGATGGGGAAAGAATGAGCTTGG - Intronic
1152591780 17:81217145-81217167 ACCAGAGTGAATAATGATCTAGG + Intronic
1152772282 17:82177574-82177596 ACATGAATGAAGGACGAGCTAGG + Intronic
1156133080 18:34002279-34002301 ACATCAGTGCAGCAAGAGCTTGG - Intronic
1156697619 18:39786019-39786041 ACAATAGTGAAAAATAAGCTAGG - Intergenic
1156742586 18:40350202-40350224 ACATGAATGAAGAAAGTGCCAGG + Intergenic
1159926508 18:74274604-74274626 ACAGGAATGAAGAATGGGCCTGG - Intronic
1165576732 19:36826117-36826139 TATTGAGTGAAGGATGAGCTGGG + Intronic
1165977056 19:39685379-39685401 ACATAAGTGAAGAATCCTCTGGG - Intergenic
926353581 2:12019740-12019762 ATATGGGTGAGGGATGAGCTGGG - Intergenic
928339670 2:30431671-30431693 ATATAAGGGCAGAATGAGCTGGG + Intergenic
931346629 2:61452732-61452754 ACAAAAGTTAAGAATTAGCTGGG + Intronic
931439104 2:62274983-62275005 ACATGTGTGAAGAGGGGGCTGGG - Intergenic
932597933 2:73105807-73105829 ACATGGGGGAAGACTGAGGTGGG + Intronic
933427416 2:82130211-82130233 ACCTGGGTAAAGAATGAGATTGG + Intergenic
934676723 2:96254520-96254542 ACATGAGTGAAGAAGGAACCAGG - Intronic
938015496 2:127863801-127863823 AAATGAGTGAAGAATAGGCAAGG + Exonic
939415336 2:141888792-141888814 ACAGGAGTGAAAAATGAGGTTGG + Intronic
939494823 2:142915448-142915470 ACTTAAGTCAAGCATGAGCTAGG + Intronic
939895034 2:147781380-147781402 ACTTGAGTTATGAATTAGCTTGG + Intergenic
940180176 2:150923416-150923438 ACTTGAGTGGAAAATGTGCTTGG - Intergenic
940381926 2:153024949-153024971 ACAAGAGGGAAGAAAGAGCGGGG - Intergenic
941801900 2:169669210-169669232 ACATGAGGCAAGCAAGAGCTTGG + Intronic
944284268 2:197930967-197930989 ACATCAGTGCTGAATGAGCAGGG + Intronic
945835254 2:214832150-214832172 AAATGAGAGAAGAGAGAGCTAGG + Intergenic
1169427263 20:5506233-5506255 AAATGAGTGAAAAATGTGCATGG - Intergenic
1170789650 20:19497195-19497217 TCATGGGCTAAGAATGAGCTGGG - Intronic
1171182441 20:23100785-23100807 CCATGAGTGAACAAGGAGCCAGG + Intergenic
1171752791 20:29070396-29070418 ACATCTGTGAAGAATGAAATTGG - Intergenic
1171789473 20:29507172-29507194 ACATCTGTGAAGAATGAAATTGG + Intergenic
1172004969 20:31812799-31812821 AAGTGAGTGAAGAATCAGTTTGG - Intergenic
1172105751 20:32516417-32516439 ACAAGGGTGAAGGATGAGCAGGG + Intronic
1173619483 20:44425813-44425835 ATAAGAATGAAGAATTAGCTGGG - Intronic
1174517179 20:51101587-51101609 GTATCAGTGAAGAATGCGCTTGG - Intergenic
1176335174 21:5590253-5590275 TCAGGAGTGAAGAATGAGGCAGG + Intergenic
1176392583 21:6230695-6230717 TCAGGAGTGAAGAATGAGGCAGG - Intergenic
1176468836 21:7085479-7085501 TCAGGAGTGAAGAATGAGGCAGG + Exonic
1176492397 21:7467257-7467279 TCAGGAGTGAAGAATGAGGCAGG + Intergenic
1176508245 21:7671126-7671148 TCAGGAGTGAAGAATGAGGCAGG - Intergenic
1177757132 21:25361524-25361546 TCATGAGTGAAGCATGTTCTTGG + Intergenic
1178896429 21:36562415-36562437 ACTTAGCTGAAGAATGAGCTGGG - Intronic
1180409584 22:12592460-12592482 ACATCTGTGAAGAATGAAATTGG - Intergenic
1181859439 22:25806668-25806690 AAAGGAGAGAAGCATGAGCTTGG - Intronic
1183848844 22:40566081-40566103 CCATGAGGCAGGAATGAGCTTGG + Intronic
1184722930 22:46325927-46325949 AAATGAGTGAAGAGGAAGCTGGG - Intronic
949495843 3:4631251-4631273 AGATGACTGCAGTATGAGCTTGG + Intronic
949831322 3:8217530-8217552 ACATGAGTTAAGAGTGGGCAAGG + Intergenic
952484424 3:33795977-33795999 ACATGAGGCAAGAAAGATCTTGG + Intergenic
952972963 3:38666360-38666382 ACATCTGTGAAGAATGTCCTTGG - Intergenic
953425595 3:42794887-42794909 AAATGAGTAAATAATGAGCTAGG - Intronic
954438163 3:50506923-50506945 ACAAGAGTCCAGAATGGGCTGGG - Intergenic
954551710 3:51487352-51487374 ACATGAGGGAAAACTGAACTGGG - Intronic
955573472 3:60332447-60332469 TTATGAATGAAGAACGAGCTAGG + Intronic
957951747 3:87136239-87136261 CCATGTGTGAAGAATGAATTTGG - Intergenic
957962504 3:87276049-87276071 ACATAAGAAAAGAATGAACTTGG - Intronic
958896748 3:99838080-99838102 CCAAGCATGAAGAATGAGCTTGG - Intronic
959066624 3:101663587-101663609 ACTTGAGTAAAGAAAGACCTTGG + Intronic
959989472 3:112615305-112615327 ACATGAGTAAAGATTCTGCTTGG + Intronic
960317839 3:116199991-116200013 AAATGAATGTAGAAGGAGCTGGG + Intronic
960709693 3:120515328-120515350 ACATGTGTGAAGAATTCTCTAGG + Intergenic
960942807 3:122945745-122945767 GCCTAAGTGAAGACTGAGCTGGG - Intronic
965185874 3:165462649-165462671 TCAAGAGTGAAGAATGAGTTTGG + Intergenic
965735996 3:171821756-171821778 AGATAAGTGAAGAATCAGATAGG + Intergenic
966422185 3:179744783-179744805 ACAGGAGGGAAGTGTGAGCTTGG - Intronic
966567564 3:181400150-181400172 ACACGATTGCAGAAGGAGCTCGG - Intergenic
966635611 3:182129913-182129935 ACTTAAGTGAAAACTGAGCTGGG + Intergenic
968869016 4:3231930-3231952 GCATGAGTGCACAAAGAGCTGGG - Intronic
970050578 4:11910103-11910125 TCCTGAGTGAAGAACAAGCTTGG + Intergenic
970655926 4:18229816-18229838 ACAGAAGTCAAGAATGAGGTTGG - Intergenic
970905152 4:21207244-21207266 ACAAGAGTTAAAGATGAGCTTGG + Intronic
974046643 4:56904215-56904237 ACATGAGGGAAGACTGTGATGGG + Intergenic
974329582 4:60460773-60460795 ACATGAGGGGAAAATGAGGTGGG + Intergenic
975322611 4:73025423-73025445 ACGTGAGTGGAGAATAAGATGGG + Intergenic
978498165 4:109382254-109382276 ACATTACTGAAGATGGAGCTGGG - Intergenic
980656466 4:135793687-135793709 ACAGGAGTGAAGAAGCTGCTGGG - Intergenic
982338750 4:154271069-154271091 ACATGAAAGAAGAATTAGCAAGG + Intronic
983936691 4:173507569-173507591 AGATGTGGGAAGAAAGAGCTTGG - Intergenic
985338530 4:188922146-188922168 ACAGGAGTGAAGAAGCTGCTGGG + Intergenic
985963075 5:3317930-3317952 AAATCAGAGGAGAATGAGCTAGG - Intergenic
986525293 5:8667283-8667305 ACATGAGTCAAAAATAAGTTGGG - Intergenic
987942872 5:24564893-24564915 AGATGAGAGCAGAATGAGCAGGG - Intronic
989410452 5:41113920-41113942 ACCTAAGTGAAGAATGACCTTGG - Intergenic
989559217 5:42831912-42831934 ACCTTAGGGAAGAATGGGCTGGG - Intronic
990703220 5:58497850-58497872 ACATCAGTTAGGAATGAGTTGGG + Intergenic
990731158 5:58810890-58810912 AAATGAGTGAATAAGGGGCTGGG - Intronic
991226046 5:64273497-64273519 ACATACTTGAAGAATGAGCAAGG + Intronic
992661463 5:78965732-78965754 TCAGGACTGAAGAAAGAGCTAGG - Intronic
992787502 5:80183982-80184004 ACATGAGTGATGAAACAGCATGG + Intronic
993353467 5:86878004-86878026 ACATTAGTGAACTATGAACTTGG - Intergenic
995125499 5:108573866-108573888 ACATGAGTGAATAATCAGGCAGG + Intergenic
996352932 5:122565232-122565254 ACATTGGTGTAGAATGAACTTGG + Intergenic
998849375 5:146338959-146338981 AGATGAGTGAAGAAGCAGGTGGG + Intronic
999581563 5:153044175-153044197 ACATAAGTGAAGAATAAACTGGG + Intergenic
1000239492 5:159396368-159396390 CCATGAGGCAGGAATGAGCTCGG + Intergenic
1000336917 5:160248300-160248322 AAGTCAGTGAAGAAAGAGCTGGG - Intergenic
1002604449 5:180374024-180374046 ACAAAAATGAAAAATGAGCTGGG + Intergenic
1005106583 6:22230228-22230250 ACAGGAGGGAAGAAAAAGCTGGG - Intergenic
1005690371 6:28299067-28299089 AGATTAGTGAAGACTGAGCCAGG + Intronic
1008530621 6:52454771-52454793 AAACCAGTAAAGAATGAGCTGGG - Intronic
1012055587 6:94404824-94404846 TCATCAGTAAAGAATGAGATGGG + Intergenic
1014115531 6:117664378-117664400 ACATGAGTGAATAATCAGAGAGG + Intergenic
1014797526 6:125743760-125743782 ACATGATTCAATAATGACCTAGG + Intergenic
1017997264 6:159542862-159542884 CCATGAGTGAACACTGAGGTTGG - Intergenic
1018682214 6:166274068-166274090 ACATGGGTGAAGATTGACTTTGG - Intergenic
1020771070 7:12395904-12395926 ACTTGACTGATGAATGAGATGGG - Intronic
1021381469 7:19972154-19972176 ACATGCCTGATGAATGAGGTTGG - Intergenic
1023303831 7:38802374-38802396 TCATGAGTGAAGAATAAAGTAGG - Intronic
1023333557 7:39144932-39144954 GCATGAGTCAATAATGACCTGGG - Intronic
1023445987 7:40232130-40232152 ACAAGAGTCAAAAATGAGGTAGG + Intronic
1023554003 7:41400950-41400972 ACATGAGTGATGGATGGGATTGG - Intergenic
1024675882 7:51637673-51637695 ACATGAAAGAAGAATAATCTGGG + Intergenic
1028366185 7:90035570-90035592 ACTTGAATGCAGAATGAGTTGGG + Intergenic
1029042750 7:97594861-97594883 TGCTGAGTCAAGAATGAGCTTGG - Intergenic
1031434418 7:121714723-121714745 ACACTAGTGAGGAATGAGGTTGG + Intergenic
1031454109 7:121958266-121958288 TCATGAGTGAAGAATGAGTTTGG - Intronic
1033130759 7:138743664-138743686 ACCAAAGTGAAGACTGAGCTAGG - Intronic
1033763018 7:144457238-144457260 ACAGGAGAGAAGCATGAGGTGGG + Intronic
1034288706 7:149909648-149909670 ACATGAAGGAATAATGAACTGGG + Intergenic
1034662371 7:152783222-152783244 ACATGAAGGAATAATGAACTGGG - Exonic
1035644211 8:1205993-1206015 ACAAAAGTGAAGAGTGACCTTGG + Intergenic
1037252287 8:16910171-16910193 ACATTATTGAAGAATGACTTTGG - Intergenic
1037327624 8:17709477-17709499 TCCTGAGCGAAGAATGAGCAGGG - Intronic
1038941828 8:32313538-32313560 ACAACACTGAAGTATGAGCTTGG + Intronic
1039291328 8:36097086-36097108 ACTTGAGTCAGGAATGAGGTTGG - Intergenic
1040751970 8:50721029-50721051 AAATGAATAAAGAATGTGCTGGG + Intronic
1041539707 8:58969705-58969727 ACAGGAGTGGAGAATGATCTCGG - Intronic
1041850088 8:62380859-62380881 TCATGTGTGAAATATGAGCTCGG + Intronic
1042393607 8:68264943-68264965 ACATGAGGAAAGAATCATCTTGG - Intergenic
1044496932 8:92897503-92897525 TCATGATAAAAGAATGAGCTTGG + Intronic
1044524708 8:93239544-93239566 CAATGGGTGGAGAATGAGCTGGG + Intergenic
1045624448 8:104026786-104026808 ACAACAGTGATGAAGGAGCTTGG + Intronic
1047183933 8:122615021-122615043 ACATGAATGAATGATGAGCTAGG + Intergenic
1047282849 8:123460776-123460798 AAATGAGGGAAGAATGGACTTGG + Intronic
1048176825 8:132160227-132160249 CCATGAGTGCAGAATGACCTCGG - Intronic
1048200237 8:132367335-132367357 ACATGGGTGTATAAAGAGCTAGG + Intronic
1048346948 8:133583189-133583211 ACATGAGTGAAGAAGCCTCTAGG - Intergenic
1048758400 8:137764905-137764927 ACATGAATGAAGCAAGAGCCAGG + Intergenic
1049386044 8:142343679-142343701 AGATGAGTGAAGAGTGAACGGGG + Intronic
1050228612 9:3492306-3492328 ACATGAGTGTCAAATGAGCAGGG - Intronic
1050246617 9:3696626-3696648 ACATCAGTGAAGAGTGAGGGTGG - Intergenic
1050516411 9:6448754-6448776 ACAGGAGTTAAGAATGTGGTAGG + Intronic
1050573572 9:6968182-6968204 ACATGAATGAACAATGCCCTGGG + Intronic
1053251581 9:36578554-36578576 GAATGAGGGAAGAATGAGGTGGG + Intronic
1053530363 9:38875089-38875111 ACATGAGTGAGAAAGGAGATTGG - Intergenic
1053607448 9:39675214-39675236 AAATGGGTGAGGAATGAGCTTGG + Intergenic
1053865297 9:42431571-42431593 AAATGGGTGAGGAATGAGCTTGG + Intergenic
1054202589 9:62099519-62099541 ACATGAGTGAGAAAGGAGATTGG - Intergenic
1054246087 9:62667195-62667217 AAATGGGTGAGGAATGAGCTTGG - Intergenic
1054560209 9:66701728-66701750 AAATGGGTGAGGAATGAGCTTGG - Intergenic
1054635773 9:67488846-67488868 ACATGAGTGAGAAAGGAGATTGG + Intergenic
1054961613 9:70976206-70976228 ACATGGGTCAAGAAGGAGCAAGG + Intronic
1056032559 9:82568082-82568104 ACATGGGTGATTGATGAGCTAGG - Intergenic
1057220347 9:93254311-93254333 TCACGAGGGAAGAAGGAGCTTGG - Intronic
1057307437 9:93920466-93920488 TCAGGAGTGAAGAAGGTGCTGGG + Intergenic
1058189565 9:101896340-101896362 AGATGAGTAAAGGAAGAGCTAGG + Intergenic
1058432556 9:104931597-104931619 ACATTTGTAAAGTATGAGCTTGG - Intergenic
1058934070 9:109751591-109751613 ACATGGAAGAAGAACGAGCTAGG - Intronic
1058989691 9:110242828-110242850 GCTTGAGTCAAGAAAGAGCTTGG - Intergenic
1059487076 9:114635043-114635065 AGATGACTAAAGAATGGGCTGGG + Intronic
1062303063 9:135886724-135886746 ACAAGAGTGGAGAATGAGCGTGG + Intronic
1203426466 Un_GL000195v1:44667-44689 TCAGGAGTGAAGAATGAGGCAGG - Intergenic
1185560264 X:1055550-1055572 ACGTGGGTGAAGAAGGAGTTTGG + Intergenic
1187120786 X:16404264-16404286 AGAAGGGTGAAGAAAGAGCTGGG + Intergenic
1187216361 X:17280997-17281019 TCATGAGATAAGAAAGAGCTTGG - Intergenic
1188207535 X:27378942-27378964 ACATGAGTGAGGCAGGAGATTGG - Intergenic
1188578153 X:31678602-31678624 AAAGAAGAGAAGAATGAGCTGGG + Intronic
1188986155 X:36770089-36770111 GCATGAGTGCAGATTGAGGTAGG - Intergenic
1190143208 X:47866094-47866116 ACATGAATGAAAATTGATCTTGG + Intronic
1190264146 X:48817518-48817540 GCATGAGTAAACAATGGGCTGGG - Intronic
1190486413 X:50929718-50929740 ACATGACTAATGAATGAGTTTGG + Intergenic
1190497996 X:51045524-51045546 CCTTGAGTGAGGAAGGAGCTGGG + Intergenic
1190947375 X:55109114-55109136 ACTTGAGTAAAGAATGGGATTGG + Intronic
1192678464 X:73225428-73225450 ACTGGAGTGCAGTATGAGCTGGG + Intergenic
1193698625 X:84738807-84738829 ACATGAGGGAAGAAAGACCCTGG - Intergenic
1197359816 X:125486589-125486611 ACATGAGGGAAGAATTACCAAGG - Intergenic
1201723202 Y:17125826-17125848 ACATGTGGGAAGAATGATATAGG - Intergenic