ID: 1148688583

View in Genome Browser
Species Human (GRCh38)
Location 17:49513991-49514013
Sequence GGCCCCTAGAATCAGCCTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148688570_1148688583 22 Left 1148688570 17:49513946-49513968 CCAGTCTGCTGCCCTCCATCCCG 0: 1
1: 0
2: 1
3: 31
4: 318
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1148688579_1148688583 -8 Left 1148688579 17:49513976-49513998 CCCGGAGCTAACACTGGCCCCTA 0: 1
1: 0
2: 0
3: 1
4: 135
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1148688576_1148688583 3 Left 1148688576 17:49513965-49513987 CCCGACATGGACCCGGAGCTAAC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1148688575_1148688583 7 Left 1148688575 17:49513961-49513983 CCATCCCGACATGGACCCGGAGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1148688572_1148688583 11 Left 1148688572 17:49513957-49513979 CCCTCCATCCCGACATGGACCCG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1148688577_1148688583 2 Left 1148688577 17:49513966-49513988 CCGACATGGACCCGGAGCTAACA 0: 1
1: 0
2: 1
3: 4
4: 50
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1148688580_1148688583 -9 Left 1148688580 17:49513977-49513999 CCGGAGCTAACACTGGCCCCTAG 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1148688573_1148688583 10 Left 1148688573 17:49513958-49513980 CCTCCATCCCGACATGGACCCGG 0: 1
1: 0
2: 1
3: 3
4: 59
Right 1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148688583 Original CRISPR GGCCCCTAGAATCAGCCTAG GGG Exonic
900470785 1:2853977-2853999 GGCCCCCAGACACTGCCTAGGGG + Intergenic
903540987 1:24096263-24096285 GGCCACTAAAATCACCCAAGTGG + Intronic
908098021 1:60760851-60760873 GGCCCATACAATCAGGCTATAGG - Intergenic
910129451 1:83886303-83886325 GGTCCCTAGAATTGGCCCAGGGG + Intronic
910723304 1:90311500-90311522 TGCCCCTACAATAGGCCTAGAGG + Intergenic
915951691 1:160193540-160193562 TGCCCCTGGATTAAGCCTAGGGG - Intronic
917459906 1:175221025-175221047 GGCCCCTTGCATAACCCTAGTGG + Intergenic
919320866 1:196036155-196036177 GGCAACATGAATCAGCCTAGAGG - Intergenic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
1063615189 10:7594380-7594402 GGCCCCTAGAGGGAGCTTAGAGG - Intronic
1072829958 10:98647223-98647245 GGCCCCTAGATTCAGTCTTCAGG + Intronic
1073488374 10:103836234-103836256 GCCCCCTATGATCAGGCTAGGGG - Intronic
1076242405 10:128918646-128918668 GGCCTCGAGAAACAGCATAGTGG + Intergenic
1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG + Intergenic
1086407283 11:86509178-86509200 AGTCCCTGGAATCAGCCTTGGGG - Intronic
1088420146 11:109636223-109636245 GGCCACTAGGGTCAGCCTGGTGG + Intergenic
1093137812 12:15473017-15473039 GGCACCTTGAAGCAGTCTAGGGG - Intronic
1102034509 12:109763076-109763098 GGACCACAGAGTCAGCCTAGAGG - Intronic
1103613510 12:122138106-122138128 GGCACCCAGGATCAGCGTAGGGG + Intronic
1106514017 13:30437429-30437451 GGAGCCTAGAATCAGCAGAGAGG + Intergenic
1112186941 13:97136793-97136815 GGCCCCTAGAATCCCCATGGTGG + Intergenic
1113566572 13:111322982-111323004 GAACCCAAGAAGCAGCCTAGAGG + Intronic
1118710052 14:68511421-68511443 AGCTCCCAGAATCACCCTAGGGG + Intronic
1120927055 14:89808266-89808288 GGACCTTATAATCACCCTAGGGG + Intronic
1122144220 14:99679537-99679559 AGGCCCTAGACTGAGCCTAGGGG + Exonic
1128467380 15:67924379-67924401 AGGCCCCAGAAGCAGCCTAGAGG + Intergenic
1135569308 16:23536069-23536091 GGCCCCTAGCATCAGCCTCTTGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1143399702 17:6636401-6636423 GGCACCTAGAAGCAGCCAGGAGG - Intronic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1152119033 17:78406854-78406876 GGCCCCTTAACTCAGCCTGGAGG + Intronic
1153943214 18:9994786-9994808 GGCCCCTTGAATCAGCTCAGTGG + Intergenic
1157728689 18:49985389-49985411 GGCCTCTGGTAACAGCCTAGGGG + Intronic
1158339297 18:56448240-56448262 GGGCCCTAGGAGCAGCTTAGAGG - Intergenic
1167351234 19:48976107-48976129 GGCCCCTAGACTCAGTAGAGTGG - Intronic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
925936139 2:8763195-8763217 GGCCCCAAGAAACAGACTTGGGG + Intronic
932884957 2:75541303-75541325 GGGCCCTAGCACCAGCCTGGAGG + Intronic
934516059 2:94987529-94987551 GGCTCCTAGAATGAGCCCAGAGG - Intergenic
936977303 2:118232698-118232720 GGGCCCTAGAAACAGCCCAGTGG - Intergenic
937730524 2:125224040-125224062 GGCCCCGAGAAACAGCCCTGTGG - Intergenic
947679229 2:232014618-232014640 GGCCCAAAGAAGCAGTCTAGTGG + Intronic
947967345 2:234292238-234292260 GGCCTCTGGAATGAGCCTGGTGG + Intergenic
948590741 2:239048016-239048038 GGCCCCTAGACCCAGACCAGCGG - Intergenic
1172633929 20:36396711-36396733 GGCCCCTGGAATCACCCCAGAGG - Intronic
1174041976 20:47706584-47706606 GACCCCTAGCATGTGCCTAGTGG + Intronic
1176385530 21:6137137-6137159 GGCCCCCAGAAACAACCTTGGGG + Intergenic
1179737943 21:43401115-43401137 GGCCCCCAGAAACAACCTTGGGG - Intergenic
1180047885 21:45318196-45318218 AGCCCCTAGGACCAGCCTGGAGG - Intergenic
1182970048 22:34565219-34565241 GGTCCATAGAATCAGACAAGAGG + Intergenic
1183988498 22:41582771-41582793 GCACTCTAGAATCAGCCAAGAGG + Intronic
955508887 3:59659562-59659584 GGCACCTAGAATTAGCCGTGAGG + Intergenic
986313059 5:6568846-6568868 GGCCATTAGAATCACCCGAGTGG - Intergenic
995056081 5:107760448-107760470 GCAGCCTAGAATCAGCCTTGAGG + Intergenic
998747951 5:145283103-145283125 CGCCCCTAGAATCAGCATTAAGG + Intergenic
1011882711 6:92050559-92050581 GGCCCCTCCAATGAGCCTATGGG - Intergenic
1015976488 6:138796214-138796236 GGCCCCAAGAAAAAGACTAGCGG - Intronic
1024524818 7:50338968-50338990 GCCACCTAGAATCAGCCAACTGG + Intronic
1025077623 7:55956688-55956710 GGCCCCTAGAAAGAGAATAGGGG + Intronic
1031748322 7:125535505-125535527 AGGCCCTAGACTCAGCCTCGTGG - Intergenic
1032258119 7:130312969-130312991 AGCCCCAAACATCAGCCTAGTGG - Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1045564167 8:103297115-103297137 GTCCCCTAGCATCAGCCCAGAGG + Intergenic
1053482819 9:38428549-38428571 TGACACTAGCATCAGCCTAGTGG + Intergenic
1061595052 9:131623606-131623628 GGCCTCTAAAATCAGCCTCTGGG - Intronic
1062113385 9:134795064-134795086 GTCCCCTAGAATCAGAGAAGGGG - Exonic