ID: 1148694458

View in Genome Browser
Species Human (GRCh38)
Location 17:49550536-49550558
Sequence AGCCTCCGTCCTCAGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148694454_1148694458 19 Left 1148694454 17:49550494-49550516 CCGAGGGCAGGAACAGGAGGGCT No data
Right 1148694458 17:49550536-49550558 AGCCTCCGTCCTCAGTCCTGTGG No data
1148694453_1148694458 20 Left 1148694453 17:49550493-49550515 CCCGAGGGCAGGAACAGGAGGGC No data
Right 1148694458 17:49550536-49550558 AGCCTCCGTCCTCAGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148694458 Original CRISPR AGCCTCCGTCCTCAGTCCTG TGG Intergenic
No off target data available for this crispr