ID: 1148694763

View in Genome Browser
Species Human (GRCh38)
Location 17:49552191-49552213
Sequence CCGTGTAGACACTCTGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148694758_1148694763 -1 Left 1148694758 17:49552169-49552191 CCTCAATGCCAGTAAACGTGCTC No data
Right 1148694763 17:49552191-49552213 CCGTGTAGACACTCTGCGGAGGG No data
1148694755_1148694763 30 Left 1148694755 17:49552138-49552160 CCTGGAGGTTGGGCGTGCCTGTG No data
Right 1148694763 17:49552191-49552213 CCGTGTAGACACTCTGCGGAGGG No data
1148694757_1148694763 13 Left 1148694757 17:49552155-49552177 CCTGTGTGCTTGGTCCTCAATGC No data
Right 1148694763 17:49552191-49552213 CCGTGTAGACACTCTGCGGAGGG No data
1148694759_1148694763 -9 Left 1148694759 17:49552177-49552199 CCAGTAAACGTGCTCCGTGTAGA No data
Right 1148694763 17:49552191-49552213 CCGTGTAGACACTCTGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148694763 Original CRISPR CCGTGTAGACACTCTGCGGA GGG Intergenic
No off target data available for this crispr