ID: 1148701195

View in Genome Browser
Species Human (GRCh38)
Location 17:49588001-49588023
Sequence CAGGCTCCCTAGGACCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148701195_1148701201 -4 Left 1148701195 17:49588001-49588023 CCTACTTGGTCCTAGGGAGCCTG No data
Right 1148701201 17:49588020-49588042 CCTGGACTCCCCTCACTTTGGGG No data
1148701195_1148701206 8 Left 1148701195 17:49588001-49588023 CCTACTTGGTCCTAGGGAGCCTG No data
Right 1148701206 17:49588032-49588054 TCACTTTGGGGTGAAGGCAAAGG No data
1148701195_1148701198 -6 Left 1148701195 17:49588001-49588023 CCTACTTGGTCCTAGGGAGCCTG No data
Right 1148701198 17:49588018-49588040 AGCCTGGACTCCCCTCACTTTGG No data
1148701195_1148701208 22 Left 1148701195 17:49588001-49588023 CCTACTTGGTCCTAGGGAGCCTG No data
Right 1148701208 17:49588046-49588068 AGGCAAAGGTGTGCCAAGCTGGG No data
1148701195_1148701202 2 Left 1148701195 17:49588001-49588023 CCTACTTGGTCCTAGGGAGCCTG No data
Right 1148701202 17:49588026-49588048 CTCCCCTCACTTTGGGGTGAAGG No data
1148701195_1148701199 -5 Left 1148701195 17:49588001-49588023 CCTACTTGGTCCTAGGGAGCCTG No data
Right 1148701199 17:49588019-49588041 GCCTGGACTCCCCTCACTTTGGG No data
1148701195_1148701207 21 Left 1148701195 17:49588001-49588023 CCTACTTGGTCCTAGGGAGCCTG No data
Right 1148701207 17:49588045-49588067 AAGGCAAAGGTGTGCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148701195 Original CRISPR CAGGCTCCCTAGGACCAAGT AGG (reversed) Intergenic
No off target data available for this crispr