ID: 1148709191

View in Genome Browser
Species Human (GRCh38)
Location 17:49664705-49664727
Sequence TTGAACCTGGGGCAGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148709184_1148709191 -5 Left 1148709184 17:49664687-49664709 CCTCACCCGCAACTGAAGTTGAA 0: 1
1: 0
2: 0
3: 9
4: 194
Right 1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1148709182_1148709191 2 Left 1148709182 17:49664680-49664702 CCCACTTCCTCACCCGCAACTGA 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1148709185_1148709191 -10 Left 1148709185 17:49664692-49664714 CCCGCAACTGAAGTTGAACCTGG 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1148709181_1148709191 11 Left 1148709181 17:49664671-49664693 CCAAAATCTCCCACTTCCTCACC 0: 1
1: 1
2: 4
3: 44
4: 497
Right 1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1148709183_1148709191 1 Left 1148709183 17:49664681-49664703 CCACTTCCTCACCCGCAACTGAA 0: 1
1: 0
2: 0
3: 14
4: 249
Right 1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148709191 Original CRISPR TTGAACCTGGGGCAGGTATC TGG Intronic
900189554 1:1347635-1347657 TTGAGCATGGGGCATGTGTCAGG - Intronic
902210194 1:14899432-14899454 TTGAACCTGGGACAGGTTCATGG - Intronic
902732465 1:18378239-18378261 TGGAACCTGTGCCAGGAATCAGG - Exonic
903887028 1:26546552-26546574 GCGGACCTGGGGCAGGTCTCTGG + Intronic
904799734 1:33083859-33083881 CTGAACCTGGGTCAGGTACTTGG + Intronic
907321304 1:53604174-53604196 TTGAGCCTGGGGCAGGGAGATGG + Intronic
911347024 1:96709498-96709520 TTGAACCTGGGGCAGGGCGGAGG - Intergenic
911631685 1:100190619-100190641 TTCAACATGGGGCAGGGATCAGG + Exonic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
921774333 1:219079629-219079651 TAGAAAATGGGGCAGGGATCAGG - Intergenic
924515259 1:244760511-244760533 CTGACCCTGGGGCTGGTCTCAGG + Intergenic
1071403796 10:85307331-85307353 TTGTACCTTGGACATGTATCTGG + Intergenic
1072130882 10:92492781-92492803 TTCAACAAGGGGCAGGTATTTGG - Intronic
1073301108 10:102471382-102471404 ATGGACCTGGTGCAGGTATGGGG + Exonic
1076649243 10:131976460-131976482 CTGAACCTGAGGCAGGTGTGTGG - Intronic
1077868291 11:6240758-6240780 TGGAACCTGAGGGAGGTAACTGG + Intronic
1080642983 11:34168642-34168664 TTGAACTCGGGGCAGGAACCAGG + Intronic
1081491305 11:43571366-43571388 CTGAGGCTGGGGCAGGGATCAGG - Intronic
1081954264 11:47076048-47076070 TTGAAGTTGGGGGAGGGATCTGG - Intronic
1083720090 11:64599659-64599681 GCGAACCTGGGGCAGGGGTCAGG - Exonic
1084590873 11:70089510-70089532 TTGAACCTGGGGCATCTGTCTGG + Intronic
1085283907 11:75347811-75347833 TTGGACCTTTGCCAGGTATCTGG - Intronic
1086560892 11:88167862-88167884 TTGCTCCTGGGGTAGGAATCAGG - Intronic
1087121181 11:94576001-94576023 TTCAACCTGGGGTATATATCTGG - Intronic
1094116506 12:26920145-26920167 TGGAACTTAGGGAAGGTATCTGG + Intronic
1099058816 12:77879592-77879614 TTGAACCTGGGGCGGGGAGGTGG + Intronic
1102169594 12:110832245-110832267 TTGAACCTGGGGTTGGTCTTGGG + Intergenic
1106163032 13:27217241-27217263 TTAAACCTGGAGCATGTATTAGG - Intergenic
1109603515 13:64662873-64662895 TTGGCCCTGGAGCAGGCATCAGG - Intergenic
1109945256 13:69423868-69423890 TGGAACCTGAGGCAAGTCTCTGG + Intergenic
1112228919 13:97568477-97568499 TGGAAAATGAGGCAGGTATCTGG - Intergenic
1113274804 13:108716944-108716966 TTAAACATATGGCAGGTATCAGG + Intronic
1117387524 14:55230959-55230981 AAGAACCTGGGGTAGGTATCTGG + Intergenic
1117569435 14:57031708-57031730 ATGCACCTGGCCCAGGTATCAGG - Intergenic
1118229083 14:63930894-63930916 TTGAACCTGAGGAGGGGATCCGG + Intronic
1120449157 14:84643860-84643882 GTGAACCTGGGGCTTGTGTCAGG - Intergenic
1121714454 14:96063158-96063180 TTGCAGCTGGGGCGGGTCTCAGG + Intronic
1121785525 14:96657331-96657353 TTGAACCTGAGGAAGGGTTCAGG + Intergenic
1121791689 14:96704116-96704138 TTGAGCCTGGGGCAGGGAATGGG + Intergenic
1121935223 14:98012325-98012347 ATGGACCTGGGGCAGGCATCCGG + Intergenic
1126752876 15:51895298-51895320 TTGAACCTGGGGCAGGGCAGAGG - Intronic
1131807869 15:96141863-96141885 TTGACCCTTGGGCAGGTAAAGGG + Intergenic
1133975574 16:10597921-10597943 TTGATCCTGGAGCAGGTTCCAGG - Intergenic
1135056513 16:19236536-19236558 TTGAACCTGAGGGAGGTCACAGG - Intronic
1141284217 16:82655967-82655989 TTGAACCAGTGGCATGTCTCAGG + Intronic
1141314718 16:82951057-82951079 TTGAGCCAAGGGAAGGTATCTGG - Intronic
1142381271 16:89733601-89733623 GTGAACCTGGGGGAGGTAGCAGG + Intronic
1142980909 17:3670903-3670925 TTGAACTTTGGGCAGGTTTAGGG + Exonic
1144492392 17:15724928-15724950 TTGAACCTGGGGGTGGTCTTGGG - Intergenic
1144712712 17:17412885-17412907 CTGAACCTGGGCCAGCTCTCAGG + Intergenic
1146503238 17:33382214-33382236 CTGAACTTAGGGCAGGAATCTGG + Intronic
1148022486 17:44562597-44562619 CTGGGCCTGGGGCAGGTCTCAGG + Intergenic
1148557618 17:48587913-48587935 TTCAACCTGGGGCAGGCCCCAGG - Intronic
1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG + Intronic
1152210549 17:79000865-79000887 CTGCTCCTGGGGCAGGGATCTGG + Intronic
1153209880 18:2749692-2749714 CTAAAGCTGGGGCAGGTATAGGG - Intronic
1153939705 18:9967585-9967607 TTCAGCCTGGGCCAGGTCTCTGG + Intergenic
1154020779 18:10662521-10662543 TAGAACCTGGGGCTGCTCTCAGG + Intergenic
1157991418 18:52501256-52501278 TTAAAGATGGAGCAGGTATCTGG + Intronic
1158314801 18:56199982-56200004 TTGAACCTGAGGCAAATGTCTGG - Intergenic
1158894641 18:61901395-61901417 CTGGACCTGGGGCAGGTACAGGG - Intergenic
1162048297 19:8016173-8016195 TGGAACCGGGGGCAGGTGGCTGG + Intronic
1162718157 19:12646886-12646908 TTGGACCTGGGGGTGGTATTCGG - Intronic
1162987385 19:14279631-14279653 TGGAACCTGGGGTAGGTAACAGG + Intergenic
1166288247 19:41845525-41845547 TTGAAAGTGGGGCAGGTGGCGGG + Intronic
1167525151 19:49979015-49979037 TGGAGCCTGGGGCAGGGCTCGGG + Intronic
1168151915 19:54453811-54453833 TTGAACCTGGGGTGGGTTTAAGG + Intronic
1168441728 19:56374051-56374073 TTGAACCTGGGGGTGGTCTTGGG - Intergenic
926396898 2:12452843-12452865 TTCTACCTGGGGCAGGTAGTGGG - Intergenic
928402936 2:30992429-30992451 TGGACCCTGGGGCAGGTAGGTGG - Intronic
929536917 2:42789661-42789683 CTGAACCTGAGCCAGGTCTCAGG + Intronic
930159522 2:48139976-48139998 TTGAACTTGGGGCAGAGATGTGG - Intergenic
933199304 2:79430787-79430809 TTGAACCTTGGGAAGATATGTGG - Intronic
939498574 2:142952155-142952177 TTGAGCCTGGGGAAGGTGGCGGG - Intronic
943175728 2:184471521-184471543 TTGAAGTTGGGTCAAGTATCTGG - Intergenic
943853814 2:192762875-192762897 TTGCCCCAGGGCCAGGTATCAGG - Intergenic
944288699 2:197979658-197979680 ATGAACCTGGGGAAGGCAACTGG - Intronic
948713350 2:239839697-239839719 GTGAGCCTGGGGCAGGGGTCTGG - Intergenic
948913877 2:241020404-241020426 TTGAACCAGGCCCAGGCATCGGG + Intronic
1171132456 20:22666165-22666187 ATGAACCTGGGGCACCTTTCTGG - Intergenic
1173186071 20:40841221-40841243 TTGCACCTGGGGAGGGGATCAGG + Intergenic
1175606459 20:60315703-60315725 GAGTACCTGGGGCAGGTGTCAGG - Intergenic
1175727818 20:61331651-61331673 GTGAGCCTGGGGCAGGTGGCTGG - Intronic
1178127229 21:29528337-29528359 AGGAACCTGGGGGAGGTAACTGG - Intronic
1178585937 21:33870838-33870860 GTGAACGTGGGGCAGGGAGCTGG + Intronic
1181416969 22:22767222-22767244 TACAACCTGGGGCAGGTAAGTGG + Intronic
1182127759 22:27828602-27828624 TTGAAACTGGGAAAGGTCTCAGG - Intergenic
1182326571 22:29517774-29517796 TTTACCCTGGAGCAGTTATCTGG - Intronic
951477564 3:23124891-23124913 GTAAACCTGGGCCAGGTCTCAGG - Intergenic
954628815 3:52037325-52037347 CTGTAGCTGGGGCAGGTGTCAGG - Intergenic
954649768 3:52154049-52154071 TGTGACCTGGGGCCGGTATCGGG - Intronic
958653779 3:96975153-96975175 TCGATCATAGGGCAGGTATCTGG - Intronic
966574739 3:181487794-181487816 TTCAACCTGGGGGAGGAAACAGG - Intergenic
966774029 3:183528431-183528453 TTGCACTTCTGGCAGGTATCTGG - Intronic
968961173 4:3744453-3744475 CAGAACCTGGGGTAGGTAGCCGG + Intergenic
972279289 4:37586998-37587020 TTGATCCAGGGGTGGGTATCAGG + Intronic
985183229 4:187288410-187288432 TTGAATTTGGGCCACGTATCTGG + Intergenic
988820979 5:34885331-34885353 TTGAACATGGAGCTTGTATCAGG + Intronic
990532420 5:56687717-56687739 TTAACCCAGGGCCAGGTATCAGG + Intergenic
990766756 5:59192691-59192713 TTTAACCTGGGGCATGAAGCAGG - Intronic
993900357 5:93580416-93580438 TTGAACTTGGGGTTGGTAACGGG - Intergenic
998785403 5:145703455-145703477 TTGAAACTGGGGCAGCTATTTGG - Intronic
999284684 5:150387368-150387390 TTCATCCTGGGCCATGTATCAGG + Intronic
1001745606 5:174090117-174090139 TTGAACCTGGGGATGGTCTTGGG - Intronic
1003129909 6:3386693-3386715 GTGACCCTGGGGCAGGTCCCCGG - Intronic
1007474918 6:42113058-42113080 GGGAACCAGGGGCAGGTATAGGG + Intronic
1008767397 6:54935479-54935501 AAGATCCTGGGGCAGATATCTGG + Intronic
1009981532 6:70731563-70731585 GTGAAACTGAGGCAGGTAACTGG - Intronic
1011007980 6:82669479-82669501 TTGAAACTGAGTCAGATATCTGG - Intergenic
1012230421 6:96754502-96754524 TTGAAGTTCGGGCAGGTATCAGG - Intergenic
1012962205 6:105634082-105634104 TAGGAGCTGGGGCAGGTATTTGG + Intergenic
1018908596 6:168089144-168089166 TTGAACCTGTGCCCGGTGTCAGG - Intergenic
1019326769 7:442337-442359 TTGAGCCTGTGGCAGGCAACAGG - Intergenic
1019911103 7:4100945-4100967 TTCAGCCTGGGGCAGGCCTCAGG - Intronic
1022103897 7:27184980-27185002 TTGGACCTGGGGCAGGTTGGAGG + Exonic
1023223163 7:37941793-37941815 TTGAATATGGAGCAGATATCAGG + Intronic
1024965762 7:55020593-55020615 TTGAACCAGGGACAGCAATCCGG - Intronic
1025710760 7:63906112-63906134 TTGAACCATTGGCAGGTATATGG - Intergenic
1027176364 7:75906329-75906351 GTGAAACTGGGGCGGGTATGCGG + Intronic
1027328479 7:77066180-77066202 TTCAACCTATGGGAGGTATCTGG - Intergenic
1028781617 7:94743970-94743992 TGGAAGCTGGGGCAAGAATCAGG - Intergenic
1035351697 7:158251971-158251993 CTGAGCCTGGGGCAGGTATGTGG - Intronic
1036412526 8:8515579-8515601 TTGAAGCTGGTGCAGCTCTCTGG + Intergenic
1037892725 8:22631986-22632008 GTGCATCTGGGGCAGGTCTCAGG + Intronic
1037967474 8:23145568-23145590 TTGGACCAGGGGCAGGGATGGGG + Intronic
1048925535 8:139267686-139267708 GTAAACCTGGGGAAGGTATAAGG + Intergenic
1049390258 8:142364126-142364148 TGGAAGCTGGGGCAGGTAGAAGG - Intronic
1052251285 9:26400546-26400568 TTGCACCTCCGGAAGGTATCAGG + Intergenic
1058979045 9:110152307-110152329 TTGAAAATGGGGCAGATTTCAGG + Intronic
1059233516 9:112742766-112742788 CAGAACCTGGGGCAAGGATCTGG + Intergenic
1060629646 9:125143793-125143815 GAGAACCTGGGGCAGGTGTCTGG - Intergenic
1062107821 9:134765464-134765486 GGGAACCAGGGGCAGGTGTCTGG - Intronic
1190744233 X:53311833-53311855 TTGAACCTGGGGCGGGGAAGAGG + Intronic
1191996311 X:67099194-67099216 TTAAACCTTGGGAAGGTATTAGG - Intergenic
1192459285 X:71303342-71303364 AGGAACCTGGGGCAGGTAGGTGG + Exonic
1193083558 X:77428305-77428327 CAGAGCCTGGGCCAGGTATCTGG - Intergenic
1197279533 X:124518780-124518802 TTGAACCCGGGGAAGGAGTCTGG + Intronic
1200229104 X:154435257-154435279 ATGAACCTGGGGAAGGTGGCAGG - Exonic