ID: 1148710222

View in Genome Browser
Species Human (GRCh38)
Location 17:49674887-49674909
Sequence ACTGTTTTGCAGATTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148710222 Original CRISPR ACTGTTTTGCAGATTGGGGA GGG (reversed) Intronic
900462336 1:2807681-2807703 GCTGTTCTGCAGGTGGGGGAGGG - Intergenic
900753839 1:4419333-4419355 AGTGTCTTGCAGATTAGAGAGGG + Intergenic
901604272 1:10447075-10447097 AATGTGCTGCAAATTGGGGAAGG - Intronic
902137283 1:14320254-14320276 AATGTTTTCCAAATTGGGGCAGG + Intergenic
902669725 1:17964679-17964701 AGTGTTTTGCAGACTGGTGAGGG + Intergenic
905552222 1:38851338-38851360 ACTGTTGTGGGGATGGGGGAGGG - Intronic
905609324 1:39335964-39335986 TCTGTTTTGGAAATTTGGGATGG - Intronic
905906642 1:41622810-41622832 ACAGTTTTCCAGGTAGGGGATGG + Intronic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906363652 1:45186244-45186266 ACTGTTGTGCAGTGGGGGGAGGG + Intronic
908931016 1:69315901-69315923 ACAGCTTTGCTGATTGGGGAGGG + Intergenic
910173775 1:84406210-84406232 TCTGCTTTCCAGGTTGGGGATGG + Intronic
912250761 1:108010383-108010405 GTAGTTTTGCAGAGTGGGGATGG + Intergenic
913218172 1:116637953-116637975 ACTGTTTTCCTGCTTAGGGATGG + Intronic
913448862 1:118978943-118978965 ACTGATTTTCACAGTGGGGAGGG - Intronic
916389491 1:164315696-164315718 ACTGTTTTTCAGCCTAGGGATGG + Intergenic
916749624 1:167712788-167712810 ACTGTTTGGTAGTTTGAGGATGG - Intergenic
917303913 1:173608015-173608037 AGTGTGTTCCAGATTAGGGAGGG - Intergenic
917337004 1:173934755-173934777 TCACTGTTGCAGATTGGGGAGGG + Exonic
917468063 1:175300929-175300951 ACTTTTCTGCTGATTTGGGATGG - Intergenic
917517453 1:175719808-175719830 GCTGGTTTGAAGAATGGGGAGGG - Intronic
917609513 1:176672522-176672544 CCAGTGTTGTAGATTGGGGAAGG + Intronic
918434561 1:184498127-184498149 TTTGTGATGCAGATTGGGGAAGG - Intronic
918828304 1:189355865-189355887 ACTGTTTTGCAGTTGGTGGTGGG + Intergenic
920969152 1:210727766-210727788 ACTGTTTTGAATATTGGAAAGGG - Intronic
921715174 1:218410417-218410439 ACTGTTCTGTAGAGAGGGGAGGG - Intronic
922560590 1:226566483-226566505 ATAGTCTTGCAGAGTGGGGAAGG + Intronic
923173774 1:231443434-231443456 TCTGTTTTTGAGATTGGAGAAGG + Intergenic
923885450 1:238150294-238150316 ACTGTTGAGAGGATTGGGGAGGG - Intergenic
924016968 1:239737670-239737692 AATGTTTTCCAGAGTTGGGATGG + Intronic
924215529 1:241817683-241817705 ACTGTTTGGGGGCTTGGGGAGGG + Intergenic
1067166277 10:43868801-43868823 ACTATTTTGCAGATAGGTAATGG - Intergenic
1067964799 10:50899022-50899044 ACTGTTTTGAAGTTTTGGAATGG - Intergenic
1068360718 10:55972992-55973014 ATTGTTGGGCAGGTTGGGGAGGG - Intergenic
1069200636 10:65610694-65610716 ACTGTTTTACAGTTTAGGCATGG - Intergenic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1072126860 10:92454123-92454145 ACTATTTTACAGAATAGGGAAGG + Exonic
1073306546 10:102507278-102507300 ACAGTTTTGCAGCTTGGTGCAGG + Intronic
1074216664 10:111391684-111391706 ACTGTTTAGCAATTTGAGGAAGG - Intergenic
1077683412 11:4268332-4268354 CCTGTTTTGGAGTGTGGGGAGGG + Intergenic
1077719996 11:4618448-4618470 ACATCTTTGCAGATTGGGGAAGG - Intergenic
1079843897 11:25438863-25438885 ATAGATTTGCAGATTGAGGACGG - Intergenic
1080415812 11:32068946-32068968 AGCGTTTTGCAGATTAGAGAAGG + Intronic
1081062760 11:38501498-38501520 ACTGTTTTGGACATTGGTGTAGG - Intergenic
1081337749 11:41887709-41887731 ACTGTTGTGGGGTTTGGGGATGG + Intergenic
1082130753 11:48486342-48486364 ACTGCTTTATTGATTGGGGAAGG + Intergenic
1082246031 11:49923748-49923770 ACTGCTTTACTGACTGGGGAAGG - Intergenic
1082809648 11:57471663-57471685 ACAGCTTTTCAGAATGGGGAAGG + Intronic
1083673114 11:64310900-64310922 ACTGTTCTTCAGAGTGGGAAGGG - Intronic
1084410040 11:69001619-69001641 AGTGCTTTGCAGATGGGAGATGG + Intergenic
1085074301 11:73576207-73576229 AGTTTTTTTCAGTTTGGGGATGG - Intronic
1085133941 11:74067816-74067838 ACTCTTTTGCAGCTAGGGTATGG + Intronic
1085981167 11:81728313-81728335 ATTTTTTTGCAGTGTGGGGATGG + Intergenic
1086232450 11:84586856-84586878 ACTTTTTTGGAGGATGGGGATGG - Intronic
1087010049 11:93504794-93504816 TCTGTTTTGCATGGTGGGGAAGG + Intronic
1087580542 11:100046130-100046152 ACTGTTGTGGAGTTGGGGGAGGG + Intronic
1088981124 11:114864880-114864902 ACTGGTTTGGAGATGGGGTAGGG + Intergenic
1089714112 11:120339705-120339727 TCTGTTTTGCAGTTTGTGGCAGG + Intronic
1091880725 12:3975374-3975396 TCTGTTTTGTAGATTGGGAGTGG + Intergenic
1094194710 12:27735638-27735660 ACTATATTGAAGATGGGGGAGGG + Intronic
1096905371 12:54930718-54930740 AATGTTTTGCAGACAGGGGGTGG + Intergenic
1097633755 12:62096787-62096809 ACAGTTTGGCAGCTTGGGGAAGG - Intronic
1100114376 12:91285771-91285793 ACTGTTGTGGAGTGTGGGGAGGG + Intergenic
1101434729 12:104654882-104654904 CCTGTTCTGGAGATGGGGGAGGG - Intronic
1102116867 12:110409602-110409624 ATTGTTGGGCAGGTTGGGGAGGG + Intergenic
1102310540 12:111841649-111841671 CCTATTTTGCAAATTAGGGATGG + Intergenic
1102777760 12:115535417-115535439 AGGGTCTTGCAGAATGGGGATGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106331325 13:28742209-28742231 ACTGTTTTTCAGGTAGGAGATGG - Intergenic
1109126199 13:58520802-58520824 ACTGTTGTGGAGTTGGGGGAGGG - Intergenic
1109604087 13:64669136-64669158 ACTGTAGAGCAGATAGGGGATGG - Intergenic
1109955175 13:69556696-69556718 ACTACTTTGCAGAGTGGGCAAGG + Intergenic
1110428859 13:75400084-75400106 ACTATTTTGCAATTTGGGCAGGG - Intronic
1110518405 13:76444198-76444220 ACTGTTTTGGGGTTGGGGGAGGG + Intergenic
1111850832 13:93572473-93572495 TCTGTTTAGCAGATCTGGGATGG - Intronic
1117521775 14:56558277-56558299 ACTGATTTTCACTTTGGGGATGG - Intronic
1118252103 14:64171746-64171768 AGTGTTTTGCAGGTTGGGTGTGG + Intronic
1118398818 14:65360921-65360943 ATTGTTCTGCAAAATGGGGATGG + Intergenic
1118862777 14:69677609-69677631 ACTGTTTTGCAGAGGGGAGTGGG + Intronic
1119740571 14:77011429-77011451 GCTGTTGTGCAGATTGGGTGGGG + Intergenic
1123692047 15:22846306-22846328 ATTGTTTGGCATCTTGGGGAGGG + Intronic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124847419 15:33305148-33305170 AATGTTTTGCTTATTGGGGCAGG + Intergenic
1125081055 15:35673523-35673545 ACTGTTTGCCAGATAGGAGATGG - Intergenic
1125458402 15:39884830-39884852 ACTCTTGTGCAGAGTGGGGGTGG - Intronic
1125766591 15:42140660-42140682 TCTGGTTTCCAGGTTGGGGAAGG - Exonic
1126906503 15:53373597-53373619 TATGTTTCGCAGATTGAGGAGGG + Intergenic
1128805676 15:70529320-70529342 TCTGCTTAGCAGATTGGGGAGGG + Intergenic
1129153888 15:73705533-73705555 AGTGTTTTCCATCTTGGGGAAGG - Intronic
1129765377 15:78162222-78162244 CCTGTCTTGCAGATTGTTGATGG + Exonic
1129838189 15:78727085-78727107 ACTGTAATGCAGAATGGGGCGGG - Intronic
1130127295 15:81104728-81104750 AATGTTTTCCAGATTGGGATTGG - Intronic
1130304489 15:82704018-82704040 ATTGTTGGGCAGGTTGGGGAGGG - Intronic
1132783502 16:1641792-1641814 CCTGCTTTACAGCTTGGGGAAGG + Intronic
1134041333 16:11070805-11070827 AATGGTTTGCAGGTTGGGGTTGG - Intronic
1134393253 16:13839261-13839283 ACTATTTTGCAGACTGGGATGGG - Intergenic
1134633790 16:15777034-15777056 ACTGCTTTCCAGATTGGACATGG - Intronic
1135145733 16:19961307-19961329 ACTGTTCTGCAATTTGGGCAGGG + Intergenic
1135905164 16:26505369-26505391 GCTGTTTTGCAGATGGCAGAAGG - Intergenic
1136529892 16:30860981-30861003 ATTGTTGGGCAGATGGGGGAGGG - Intronic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1140492328 16:75348240-75348262 ACTATTTTGGAGACTGAGGAGGG - Intronic
1140841073 16:78839643-78839665 ACTGTTATGGAGGGTGGGGAGGG + Intronic
1141356531 16:83351953-83351975 GCTGTTTTGTAGATAGTGGATGG + Intronic
1142488022 17:259402-259424 TGTGTTTTGCAGAGTGGGGCGGG - Intronic
1143711389 17:8737995-8738017 AATTTTTTGCAGATTTGGGGGGG + Intronic
1145080736 17:19892376-19892398 ATTGTTGGGCAGGTTGGGGAGGG + Intergenic
1146404865 17:32528315-32528337 ACTGCTTTGCAGGTGGGAGAGGG + Intronic
1148221239 17:45863884-45863906 AGTGTGCTGCAGAGTGGGGAGGG - Intergenic
1148427672 17:47613678-47613700 ACTGTTTTGAAGCATGGTGATGG + Exonic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1149903865 17:60507152-60507174 ACTGTTTTGCTACTTGGGTATGG - Intronic
1150860554 17:68796530-68796552 ATTGTTGGGCAGATGGGGGAGGG + Intergenic
1151104117 17:71592478-71592500 ACTGTTTTGCTGATGTGTGATGG - Intergenic
1153050650 18:900485-900507 ACTGATTTGCAATATGGGGATGG + Intergenic
1156970217 18:43145254-43145276 ACTCTTTTGCAGATGGGTGGTGG - Intergenic
1157409068 18:47448751-47448773 ACAGGTTTGCAGGTAGGGGAAGG + Intergenic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1161711148 19:5848853-5848875 ACTGTTGGGCAGATGGAGGAGGG - Intronic
1162374309 19:10295919-10295941 ACTGTGGGGAAGATTGGGGAGGG + Intronic
1163809010 19:19418810-19418832 ACTGGTTTTGAGAGTGGGGAGGG + Intronic
1164004151 19:21133717-21133739 ATTGTTGGGCAGGTTGGGGAGGG + Intergenic
1166087776 19:40488232-40488254 ACTGTATTGCGGGTTGGGGGTGG + Intronic
1166916946 19:46201904-46201926 ATTGTTGGGCAGGTTGGGGAGGG + Intergenic
1167292173 19:48630340-48630362 ATTGCTTTTTAGATTGGGGACGG - Exonic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
926379152 2:12267009-12267031 GCTGTTTTTCAGACTGGGGCTGG - Intergenic
927417891 2:22898008-22898030 GTTGTTTTGCATACTGGGGAGGG - Intergenic
928107628 2:28481536-28481558 GCTGTTTTGCAGGCAGGGGATGG + Intronic
928478534 2:31656211-31656233 ATAGTTTTGCATACTGGGGATGG + Intergenic
928915547 2:36466228-36466250 ACAGTTCTGGACATTGGGGATGG + Intronic
933137867 2:78759668-78759690 ATTGTTGGGCAGGTTGGGGAGGG - Intergenic
933200984 2:79448212-79448234 ACAGTTTTGCAAATTTGTGAAGG + Intronic
933557154 2:83845214-83845236 ACTATTTTGCCCATTGGGTAAGG + Intergenic
933722264 2:85405675-85405697 ACTATTTTGTAGGTTGGGAAAGG - Intronic
934916616 2:98305461-98305483 AGTGATGTGAAGATTGGGGACGG + Intronic
936851595 2:116905510-116905532 GGTGCTTGGCAGATTGGGGAAGG + Intergenic
937985890 2:127637926-127637948 CCTGTTTCTCAGACTGGGGAGGG + Intergenic
940045243 2:149402878-149402900 ACTGTTGTGCGGTTGGGGGAGGG - Intronic
941089717 2:161160622-161160644 ACCAATTTGCAGTTTGGGGAGGG + Intronic
942689000 2:178565307-178565329 ACTGTTTTGCACATTAAAGAAGG - Exonic
942755818 2:179340114-179340136 AATGCTTTGCATATTGGGGCTGG - Intergenic
943554270 2:189382767-189382789 AATTTTTTGCAGGTAGGGGATGG + Intergenic
944152699 2:196577671-196577693 ACTGTCTTGCTGATTGTCGAAGG + Intronic
944397952 2:199290781-199290803 ATATTTCTGCAGATTGGGGAGGG - Intronic
944415709 2:199477731-199477753 GCTGTTTTGTAGGATGGGGAGGG - Intergenic
944646049 2:201781839-201781861 ACAGTTTTGCAGGTGGGCGAAGG - Intergenic
945283387 2:208058752-208058774 ACTGTTTTGGGGTGTGGGGAGGG + Intergenic
945284780 2:208071186-208071208 TCTGTTTTGCATGTTGGGAAGGG + Intergenic
946227839 2:218273858-218273880 ACAGTTTTGCAGATGGAGGAGGG - Intronic
946492487 2:220162903-220162925 ACTGCATTGCATGTTGGGGATGG + Intergenic
948981164 2:241495634-241495656 ACTGCTGTTCAGATAGGGGACGG - Exonic
1169274236 20:4222152-4222174 ACTATTTAGCTGCTTGGGGAGGG + Intronic
1171766282 20:29282991-29283013 ACTGTTGTGGAGTGTGGGGAGGG + Intergenic
1173138782 20:40463598-40463620 TCTGCCTTGCAGATTGGGGTAGG - Intergenic
1174492954 20:50915627-50915649 CGTGTTTTGTGGATTGGGGAGGG - Intronic
1176763992 21:12997280-12997302 ACTGTTTTGGAGTGGGGGGAGGG - Intergenic
1177906148 21:26973327-26973349 ACTGTTTTGCATTTTCTGGAAGG - Intergenic
1183255806 22:36761195-36761217 CCTGTTTTGGAGGTTGGGGTGGG + Intronic
1183635743 22:39061430-39061452 ACTGTTGGGCAGGTGGGGGAGGG + Intronic
1183749216 22:39710216-39710238 AGGGTTTTGCAGCTCGGGGAGGG - Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184561802 22:45268227-45268249 ACGGTTTTGGAGCTCGGGGAAGG - Intergenic
949578110 3:5358734-5358756 ACAGTTGTGGAGATTGGGAAAGG - Intergenic
951498651 3:23358996-23359018 ACTGTTTTTGAGATTTGGAATGG + Intronic
953605600 3:44411323-44411345 ACTGCTGTGCAGATTGGGTCAGG + Intergenic
953800548 3:46019497-46019519 TCTAATTTGCAGATTAGGGAGGG + Exonic
953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG + Intronic
953839296 3:46375849-46375871 ACTGTTTTGAATTTGGGGGATGG + Exonic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
955011120 3:55015336-55015358 TCTGTTTTGCAGATGGTGAATGG - Intronic
955338827 3:58109167-58109189 GCTTTTTTGCAGGATGGGGAAGG + Exonic
957788526 3:84911250-84911272 ACTGTTTTGGCGTGTGGGGAGGG + Intergenic
957799795 3:85061864-85061886 ACTATTTTGCAGATTCAGAAGGG - Intronic
958442906 3:94178443-94178465 ACGGGCTTGCAGACTGGGGAAGG - Intergenic
959543768 3:107570584-107570606 ACTGTTGGGCAGGTTGGGGAGGG + Intronic
960109901 3:113835882-113835904 AAAGTTTTGCAGAATGAGGATGG + Intronic
962108853 3:132420702-132420724 ACTGTTCTGCAGATTCATGAAGG + Intronic
963874874 3:150463779-150463801 ACAGATTTTCAGATTGGTGATGG + Exonic
964280261 3:155056326-155056348 ACTGTTGTGCGGTGTGGGGAGGG - Intronic
964452967 3:156829841-156829863 AATGTTTTGAAGATTTGGAATGG + Intronic
965907835 3:173731639-173731661 GCTGTTTTTCAGATTGAAGAAGG - Intronic
966501447 3:180645901-180645923 TCTGTTTTGCTGTGTGGGGATGG - Intronic
966749344 3:183306994-183307016 ACTGTTTTTCAGAATCAGGAAGG + Intronic
969006026 4:4020843-4020865 ACTTTTTTAGAGATTGGGGCAGG - Intergenic
969806922 4:9616447-9616469 ACTTTTTTAGAGATTGGGGCAGG + Intergenic
973667253 4:53174941-53174963 ACTGTTTTGCATGTTTGTGACGG + Intronic
975331462 4:73119385-73119407 ACTGGATTTCAGATTAGGGATGG - Intronic
976037674 4:80843901-80843923 ACTATTGTGGAGAGTGGGGAGGG - Intronic
976258930 4:83127531-83127553 ACTGTTTTCCAGGCTGGGCATGG + Intronic
978997799 4:115177711-115177733 ACTGTTGTGCAGTGGGGGGAGGG + Intergenic
980412755 4:132445441-132445463 CCAGTTTTGGGGATTGGGGAAGG - Intronic
983297404 4:165883326-165883348 ACTTTTTTGCAAATTGGAGTTGG + Intronic
983756734 4:171347872-171347894 ACTGTTTTCCACATTCTGGAAGG - Intergenic
984186414 4:176548881-176548903 TCTGTTTTACAGATAAGGGAAGG - Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
985196600 4:187436991-187437013 ACTGCTTTGCAGATTAGAAATGG + Intergenic
985575819 5:673134-673156 TTTGTTTTGCATTTTGGGGAGGG - Intronic
986385012 5:7224758-7224780 ACTGTCTTGCAGCTGAGGGAAGG - Intergenic
986837470 5:11655378-11655400 TGTGTTTTGCAGAATGGGGGTGG - Intronic
988109272 5:26796196-26796218 TCTGTTTTTCAGATAGGGAATGG + Intergenic
988529734 5:32017024-32017046 ACAGATGTGCAGATGGGGGATGG + Intronic
988860123 5:35268711-35268733 AATGTTTTGCAGGCTGGGGGTGG + Intergenic
989688970 5:44118644-44118666 ATTGTTGGGCAGGTTGGGGAGGG + Intergenic
990982761 5:61616623-61616645 TCTGTTTGGCATACTGGGGATGG - Intergenic
991135055 5:63172939-63172961 ACTCTTTTGCAGATTGGTTTAGG + Intergenic
992986327 5:82234209-82234231 ACTTTTAGGCAGATGGGGGAGGG + Intronic
993555616 5:89332927-89332949 ACTATTTTCCAAATTGGGGCAGG - Intergenic
993592491 5:89811532-89811554 ACTGTTGTGCAGTGGGGGGAGGG - Intergenic
995363483 5:111327156-111327178 ACTGTTGTGGAGTTGGGGGAGGG - Intronic
995963026 5:117867616-117867638 GATGTTTAGCAGATTGGGCAGGG + Intergenic
996092096 5:119361436-119361458 ATGGTTTTGAAGATGGGGGAGGG + Intronic
996394090 5:122995090-122995112 ATTGACTTGCAGATTGGAGATGG - Intronic
996726067 5:126674265-126674287 ACTGTTGGGCAGGTGGGGGAGGG + Intergenic
997175396 5:131771079-131771101 ACTGTTGTGGGGAGTGGGGAGGG - Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997448388 5:133960672-133960694 ACTATTTTGAAGATGAGGGAAGG + Intronic
998997846 5:147885432-147885454 AGTGTTTTGCATATTTGAGAAGG + Intronic
999288853 5:150410264-150410286 ACTGTGGTGCAGAGAGGGGAAGG - Intronic
999671275 5:153960763-153960785 GCTGGTTTGCAGATTGTGGGTGG - Intergenic
1000759865 5:165209126-165209148 ACTGTTTTGCAGATGTGCAAAGG + Intergenic
1002770383 6:285706-285728 ACTGCTTTGTATTTTGGGGAGGG + Intergenic
1003350753 6:5315604-5315626 GCTGTTTTTCAGATTGTAGATGG - Intronic
1005450923 6:25971541-25971563 ACTGAGTTGCAGTTTGGAGATGG - Intronic
1005998415 6:30946568-30946590 ACTGTTTTACAGGTGGGGAAAGG - Intronic
1006648573 6:35532619-35532641 ACTGTTTTGCAGAGGCTGGAGGG - Intergenic
1007342545 6:41200832-41200854 AGTGTTTTGTGGGTTGGGGAAGG - Intronic
1007949450 6:45858487-45858509 ACAGTTCTGCAGATAGGTGAAGG + Intergenic
1008309853 6:49953706-49953728 ACTGTTTTGAAGCTAGGAGAAGG + Intergenic
1009379080 6:63007079-63007101 ATTGTTGGGCAGGTTGGGGAGGG - Intergenic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1011250319 6:85364940-85364962 ACTGTTTTGGGGAGTGGGGCGGG - Intergenic
1013943044 6:115688858-115688880 ACTGTTTTGCAGAAGAGGAAGGG - Intergenic
1016014281 6:139167579-139167601 ATGGTTTTGCATAATGGGGAAGG + Intronic
1016604914 6:145909261-145909283 ACTTTTGTGGAGATTGGTGAAGG - Intronic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1018278097 6:162154152-162154174 ACTGTTTTTCAGAGTGTGGTGGG - Intronic
1021299866 7:18959176-18959198 ACTTTTTCACAGATTTGGGAGGG + Intronic
1022317725 7:29261185-29261207 ACTCTTTTACAGAATGGGGAAGG + Intronic
1024257580 7:47550029-47550051 AATGTTTAGCTGAGTGGGGATGG - Intronic
1024714283 7:52057495-52057517 ATACTTTTGCAGATGGGGGAAGG - Intergenic
1027223357 7:76228291-76228313 TCTGTTTTGCAGATTGGCTAGGG + Intronic
1028010782 7:85640997-85641019 AATATTTTTCAGATTAGGGAGGG - Intergenic
1028085985 7:86638489-86638511 ATTGTTTTGAGGATTGGGGGTGG - Intergenic
1028389105 7:90294871-90294893 ACTGGTTTGCACAGAGGGGAAGG + Intronic
1028589979 7:92483731-92483753 ATTGTTGGGCAGATGGGGGAGGG + Intergenic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1031865444 7:127034050-127034072 CCTGTTTATCAAATTGGGGAAGG + Intronic
1032619293 7:133511528-133511550 ACTTTTAGGCAGATGGGGGAGGG + Intronic
1033084439 7:138329496-138329518 AATGTTTTGCAGGCAGGGGATGG - Intergenic
1033122132 7:138675674-138675696 ACTTTTTAGCTGTTTGGGGAGGG + Intronic
1033411945 7:141126197-141126219 TTTGGTTTGCAGGTTGGGGAGGG + Intronic
1035383318 7:158454195-158454217 ACTGATGTGAGGATTGGGGATGG + Intronic
1035383330 7:158454317-158454339 ACTGATGTGAGGATTGGGGACGG + Intronic
1035383342 7:158454439-158454461 ACTGATGTGAGGATTGGGGACGG + Intronic
1035383354 7:158454561-158454583 ACTGATGTGAGGATTGGGGACGG + Intronic
1036930846 8:12953638-12953660 ACTTGTTTGAAGTTTGGGGAAGG + Intronic
1036995366 8:13648885-13648907 ACTGTTGTGCGGTTGGGGGAGGG + Intergenic
1039371889 8:36993267-36993289 ATTGTTTTGCAGATTCAGTAAGG + Intergenic
1042450256 8:68936789-68936811 ACTGTTGTGGAGTTGGGGGAGGG + Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1043524023 8:81076600-81076622 TCTGTTTTGCAGATAGGGGTTGG - Intronic
1043597523 8:81902452-81902474 ATTGTTGGGCAGGTTGGGGAGGG + Intergenic
1043655198 8:82655809-82655831 ACTGTTGTGGAGTTGGGGGAAGG - Intergenic
1044183544 8:89224196-89224218 ACTGTTGTGGAGTTGGGGGAGGG + Intergenic
1045571764 8:103374994-103375016 ACAGTTTGACAGATTGTGGATGG + Intronic
1046031087 8:108784877-108784899 ACTGTTTTGCAGAGAGGAGGAGG + Exonic
1046532011 8:115458270-115458292 ACTGTTTTGTAAATGGGGTATGG + Intronic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1048500996 8:134974881-134974903 CCTGTCTTGCAGACTGGGGAAGG - Intergenic
1052738751 9:32373171-32373193 ATTGCTTTGCAGATGGAGGAAGG + Intergenic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1055075545 9:72211708-72211730 ACTGTCTTCTAGATAGGGGAAGG + Intronic
1057852301 9:98575090-98575112 AGGGTTTTGCAGATTTGGGGGGG - Intronic
1058136579 9:101314308-101314330 TGTATTTTGCATATTGGGGAGGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1062641410 9:137520631-137520653 ACTGTTTTGGGCAGTGGGGATGG + Intronic
1185891926 X:3829285-3829307 TCTGTCTTGCAGATTGGGGCTGG + Intronic
1185902149 X:3906125-3906147 TCTGTCTTGCAGATTGGGGCTGG + Intergenic
1186423407 X:9444394-9444416 AGGGTTTTGAAGAGTGGGGAGGG - Intergenic
1186537552 X:10365463-10365485 ACTGTTTTGTAGATTAGGGTTGG - Intergenic
1187103838 X:16220739-16220761 ATTGTTGGGCAGGTTGGGGAGGG + Intergenic
1188459776 X:30411072-30411094 AGTGGTTTGCAATTTGGGGAAGG + Intergenic
1188545477 X:31301220-31301242 TCTGTGTTGCTGATTGGGGAAGG + Intronic
1189031878 X:37459730-37459752 ATTGTTGGGCTGATTGGGGAGGG + Intronic
1191947126 X:66547015-66547037 ACTGTTGTGCAGTTGGGGGAGGG - Intergenic
1192378827 X:70592730-70592752 ACTGTTTTGGAGCTAGGGGCAGG - Intronic
1192731585 X:73806833-73806855 ACTGTTGGGTAGATGGGGGAGGG + Intergenic
1195337844 X:103874249-103874271 ACTGTTGTGGAGTTGGGGGAGGG + Intergenic
1195522261 X:105844821-105844843 CCTGTTTTGTAGAGTGAGGAAGG - Intronic
1197691180 X:129502706-129502728 ACTGTTTTGCATATGTGTGAGGG + Intronic
1198196081 X:134363812-134363834 ACTTTTTTGCATCCTGGGGAGGG + Intergenic
1198279010 X:135123953-135123975 AGTGGCTTGCAGAGTGGGGAGGG + Intergenic
1198291948 X:135248567-135248589 AGTGGCTTGCAGAGTGGGGAGGG - Intergenic
1198297981 X:135305546-135305568 AGTGGCTTGCAGAGTGGGGAGGG - Intronic
1200297400 X:154934589-154934611 TCTGTTTTGCAAGGTGGGGAGGG + Intronic
1201302818 Y:12524913-12524935 ACATTTTTGCAGATGGGGGCAGG - Intergenic
1201974384 Y:19832389-19832411 ACTATTTAGCAGACTGGGAAAGG - Intergenic
1202591798 Y:26492921-26492943 ACTGTTGTGCAGTGGGGGGAGGG - Intergenic