ID: 1148713118

View in Genome Browser
Species Human (GRCh38)
Location 17:49696381-49696403
Sequence AGAAGCACTATGTTTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148713118_1148713124 21 Left 1148713118 17:49696381-49696403 CCCAGCTGAAACATAGTGCTTCT No data
Right 1148713124 17:49696425-49696447 ACCATGACAAAACACAGAAGTGG No data
1148713118_1148713126 22 Left 1148713118 17:49696381-49696403 CCCAGCTGAAACATAGTGCTTCT No data
Right 1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG No data
1148713118_1148713127 26 Left 1148713118 17:49696381-49696403 CCCAGCTGAAACATAGTGCTTCT No data
Right 1148713127 17:49696430-49696452 GACAAAACACAGAAGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148713118 Original CRISPR AGAAGCACTATGTTTCAGCT GGG (reversed) Intergenic
No off target data available for this crispr