ID: 1148713119

View in Genome Browser
Species Human (GRCh38)
Location 17:49696382-49696404
Sequence CAGAAGCACTATGTTTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148713119_1148713124 20 Left 1148713119 17:49696382-49696404 CCAGCTGAAACATAGTGCTTCTG No data
Right 1148713124 17:49696425-49696447 ACCATGACAAAACACAGAAGTGG No data
1148713119_1148713127 25 Left 1148713119 17:49696382-49696404 CCAGCTGAAACATAGTGCTTCTG No data
Right 1148713127 17:49696430-49696452 GACAAAACACAGAAGTGGGCAGG No data
1148713119_1148713126 21 Left 1148713119 17:49696382-49696404 CCAGCTGAAACATAGTGCTTCTG No data
Right 1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148713119 Original CRISPR CAGAAGCACTATGTTTCAGC TGG (reversed) Intergenic
No off target data available for this crispr