ID: 1148713126

View in Genome Browser
Species Human (GRCh38)
Location 17:49696426-49696448
Sequence CCATGACAAAACACAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148713119_1148713126 21 Left 1148713119 17:49696382-49696404 CCAGCTGAAACATAGTGCTTCTG No data
Right 1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG No data
1148713118_1148713126 22 Left 1148713118 17:49696381-49696403 CCCAGCTGAAACATAGTGCTTCT No data
Right 1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG No data
1148713117_1148713126 23 Left 1148713117 17:49696380-49696402 CCCCAGCTGAAACATAGTGCTTC No data
Right 1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148713126 Original CRISPR CCATGACAAAACACAGAAGT GGG Intergenic
No off target data available for this crispr