ID: 1148714636

View in Genome Browser
Species Human (GRCh38)
Location 17:49707469-49707491
Sequence TCTAAGGGCCTGCGTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148714636 Original CRISPR TCTAAGGGCCTGCGTTTTAC AGG (reversed) Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904558238 1:31379610-31379632 TCTAAGGGCCTCCGGTGTAATGG - Intergenic
1066986711 10:42475065-42475087 CCTAACGGCCTGCGGTTGACCGG + Intergenic
1069611863 10:69778620-69778642 TCTAAGCGCCTGATTTTTGCGGG - Intergenic
1074077297 10:110140728-110140750 TCTTAAGGCCTGCATTTTGCTGG - Intergenic
1074110757 10:110421227-110421249 TCCAGGGGCCTGTGTTTAACAGG + Intergenic
1077124802 11:928105-928127 TGCCAGGGCCTGCGTTTGACAGG + Intronic
1086066495 11:82750715-82750737 ACTAAGGCCCTGGGTTTTTCTGG - Intergenic
1086162502 11:83738139-83738161 TCCAAGGGTCTGTGTTTTCCAGG + Intronic
1087965590 11:104410040-104410062 TTAAGGGGCCTGTGTTTTACTGG + Intergenic
1091344806 11:134845479-134845501 ACTCAGGGCCTGGGCTTTACTGG - Intergenic
1091982975 12:4881530-4881552 TTTTAGGGATTGCGTTTTACTGG - Intergenic
1096153710 12:49330493-49330515 TCTAGGGGCCTGGGTTCTGCTGG - Exonic
1096153731 12:49330592-49330614 TCTAGGGGCCTGGGTTCTGCTGG - Exonic
1101479742 12:105084961-105084983 TCTACAGGCGTGCCTTTTACGGG - Intergenic
1101813258 12:108126148-108126170 GCTAAGGGGCTGCTTTTTGCTGG - Intergenic
1105544025 13:21338967-21338989 GGTAAGGGCCTGGGCTTTACTGG - Intergenic
1108174786 13:47781161-47781183 TCTAAGTGCCTGCTCTGTACAGG + Intergenic
1117440600 14:55755650-55755672 TCAAAGAGCTTGCGATTTACTGG - Intergenic
1124233305 15:27965627-27965649 TCTGCTGGCCTGTGTTTTACAGG - Intronic
1140281398 16:73558172-73558194 TCTAAATGCCTGCATTTTATGGG + Intergenic
1142766536 17:2067623-2067645 TCTAAGGGCCTGGATTTAAGAGG + Intronic
1148714636 17:49707469-49707491 TCTAAGGGCCTGCGTTTTACAGG - Intronic
1150573279 17:66406881-66406903 TCTAAGGGACTGCGAATTGCTGG + Intronic
1151733239 17:75923213-75923235 TCTGAGGGCCTGCATTTGGCGGG - Exonic
1157037656 18:43995431-43995453 TCTAATGGCATGAGTTTAACAGG + Intergenic
1159079551 18:63721891-63721913 CCTAAGGGCCTGTGGTTGACTGG + Intronic
1163844950 19:19633454-19633476 TCTCAGTGCCTGTGTTTTAGTGG - Intronic
1166354667 19:42219922-42219944 TCTCCGGGCCTCTGTTTTACTGG - Intronic
1167340463 19:48912930-48912952 GCCAAGGGCCTGCCATTTACAGG + Intronic
926358716 2:12065248-12065270 TCTCAGGGTCTGCTTTTTCCGGG + Intergenic
934309394 2:91849947-91849969 TCTATGGGCCTGGGTTTTGATGG - Intergenic
942087388 2:172456111-172456133 TCTAAGGGCCAGTGATTAACAGG - Intronic
949044939 2:241868085-241868107 TCTAAGGTCCTGGGGTTTGCTGG - Intergenic
1170079270 20:12453825-12453847 TCTAAAAGACTGGGTTTTACAGG - Intergenic
1175621084 20:60448197-60448219 TCCAAAGGGCTGCGTATTACAGG - Intergenic
1184386693 22:44180662-44180684 TTTAAGGGCTTTCATTTTACTGG - Intronic
950795199 3:15504904-15504926 TCTAAGGTACTGGGTATTACTGG + Intronic
961609525 3:128125439-128125461 TCAAAAGGCCTGCAGTTTACTGG - Intronic
964411751 3:156405134-156405156 TCACTGGGCCTGCTTTTTACAGG - Intronic
966456985 3:180128329-180128351 TCTAAGAGCCGGGGCTTTACAGG + Intergenic
966570319 3:181434625-181434647 TCTAAGTGCCTGGCTTTTTCTGG - Intergenic
969717686 4:8876107-8876129 TGTAAGAGCCTGAGTTTTTCTGG + Intergenic
982296979 4:153838992-153839014 TTTCAGGGCATGCATTTTACTGG + Intergenic
989308478 5:39985068-39985090 TGTAAGGAACTGCTTTTTACTGG + Intergenic
997231431 5:132246547-132246569 TCTAAGATACTGCGTATTACAGG - Intronic
997247755 5:132365319-132365341 TCGTAGGGCCTGCATTCTACAGG + Intergenic
1002183952 5:177445420-177445442 TCTAAGTGCCTGTGTGTTAAGGG - Intergenic
1003751091 6:9056940-9056962 TCTAAGGGCCTGCATTTTCCAGG - Intergenic
1006162862 6:32048223-32048245 GCTCAGGGCCTGGGTTTTCCTGG + Intronic
1014655165 6:124093957-124093979 TTTAAGGGCCTGATTTTAACTGG + Intronic
1015132099 6:129823971-129823993 TCCAAGGGTGTGAGTTTTACAGG + Intergenic
1015146192 6:129990429-129990451 TCTGAGGACCTCTGTTTTACAGG - Intergenic
1024064722 7:45722669-45722691 TGTAAGCGCCTGCGTTCTTCTGG + Exonic
1031909455 7:127499710-127499732 TGGAAGGGGCTGCTTTTTACAGG - Intergenic
1034642522 7:152615456-152615478 TCTAGGGGACAGCGTTTCACTGG - Intergenic
1045148479 8:99375025-99375047 TCTATGGGCCTGCACTTCACCGG + Intronic
1051369758 9:16348382-16348404 TCTAAAGGAATGCCTTTTACTGG - Intergenic
1054913953 9:70478995-70479017 TCCAAGGGCTTGTGTTCTACTGG + Intergenic
1057111490 9:92476316-92476338 TCCATGGGCCTGCTTTTTCCTGG + Intronic
1058397283 9:104568993-104569015 TCTAGTGGCCTGGGTTTTACAGG + Intergenic
1062046155 9:134425501-134425523 TCTGAGGGCCTGGGTTGCACAGG + Intronic
1193569881 X:83128626-83128648 GCTAAGGTCCTGTGTTTTCCTGG + Intergenic
1200112649 X:153749901-153749923 TCTATGGGCCTGGGTTTTGATGG - Intergenic