ID: 1148715371

View in Genome Browser
Species Human (GRCh38)
Location 17:49711899-49711921
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148715365_1148715371 -8 Left 1148715365 17:49711884-49711906 CCTATAATCCCAGCACTTTGGAA 0: 1158
1: 38766
2: 329426
3: 249898
4: 134520
Right 1148715371 17:49711899-49711921 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1148715363_1148715371 11 Left 1148715363 17:49711865-49711887 CCGGGCACGGTGGCTCACGCCTA 0: 768
1: 15146
2: 72131
3: 127206
4: 156024
Right 1148715371 17:49711899-49711921 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148715371 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr