ID: 1148715503

View in Genome Browser
Species Human (GRCh38)
Location 17:49712840-49712862
Sequence AGGGTGAGACAGATATGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148715503_1148715507 17 Left 1148715503 17:49712840-49712862 CCTTGTCATATCTGTCTCACCCT 0: 1
1: 0
2: 0
3: 16
4: 200
Right 1148715507 17:49712880-49712902 TTTTAATTGTTTTTAGAGACAGG 0: 3
1: 79
2: 1128
3: 8773
4: 58282
1148715503_1148715508 18 Left 1148715503 17:49712840-49712862 CCTTGTCATATCTGTCTCACCCT 0: 1
1: 0
2: 0
3: 16
4: 200
Right 1148715508 17:49712881-49712903 TTTAATTGTTTTTAGAGACAGGG 0: 3
1: 78
2: 1301
3: 9240
4: 50512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148715503 Original CRISPR AGGGTGAGACAGATATGACA AGG (reversed) Intronic
900539823 1:3197127-3197149 AGGGGGACTCAGGTATGACAAGG - Intronic
901032064 1:6312951-6312973 AGATTGAGAGAGACATGACACGG + Intronic
903772749 1:25774227-25774249 AGGGTCAGACAGATCGGACTGGG + Intronic
908009511 1:59761675-59761697 AGAGTCAGCCAGATAGGACAGGG + Intronic
910207852 1:84765519-84765541 AGGGTGAGTCAGATAGGACCAGG + Intergenic
912865514 1:113252761-113252783 AGAGTGAGACAGAGAGGACGGGG + Intergenic
915032220 1:152890854-152890876 AGAGTTAAACAAATATGACATGG - Intergenic
916687164 1:167157917-167157939 AGGGTGAGACTGAGAGGGCAAGG - Intergenic
917845967 1:179020413-179020435 AGGATGAGAAAGATGTGACAAGG - Intergenic
919440943 1:197633082-197633104 AGGGTGAGAGAAATATGGAATGG + Intronic
920110978 1:203586807-203586829 ATAGTGAGACAGATCAGACAAGG - Intergenic
921223117 1:212988396-212988418 AGGATGAGACAAATATCAGAAGG + Intronic
1065966035 10:30771099-30771121 AGGTGGAGAAAGATCTGACATGG - Intergenic
1068481835 10:57599579-57599601 AGCATTAGACAGATATGAAATGG + Intergenic
1068785605 10:60969239-60969261 AGGGTGCGGCACATATGACTTGG + Intronic
1069664235 10:70144432-70144454 TTGGTGGGTCAGATATGACATGG + Intronic
1070036292 10:72728483-72728505 AAGCTGAGACATATATGACAAGG + Intronic
1070674129 10:78400211-78400233 AGGGTCAGACTGACATGACAGGG + Intergenic
1070715135 10:78714655-78714677 AGGGTGAGAGAGCTATGTCTTGG + Intergenic
1070971649 10:80572110-80572132 AGGGTGAGACAGAAGAGACTTGG + Intronic
1073201813 10:101741336-101741358 AGGTTGAGAGAGATAGGAAATGG + Intergenic
1073498437 10:103915302-103915324 AGGGTCAGACTGATATGATCTGG + Intronic
1075078143 10:119365090-119365112 AGGCTGAGACAGAGCTTACAAGG + Intronic
1075197214 10:120370373-120370395 AGAGTGAGAAAGAGAGGACAAGG - Intergenic
1080219237 11:29881097-29881119 ACGGTGAGAGAAATATGACATGG + Intergenic
1080412431 11:32038410-32038432 CTGGTGAGACAGAAAAGACAAGG - Intronic
1081921756 11:46784742-46784764 AGCATGTAACAGATATGACATGG + Intronic
1081999954 11:47388809-47388831 AGCGTGAGCCAGAGATGGCAAGG + Intergenic
1082130490 11:48482805-48482827 AGGGTCAGAAAGATGTAACAAGG - Intergenic
1082194971 11:49292963-49292985 AGGGTGAGACAGATATTGTGGGG + Intergenic
1082246631 11:49930873-49930895 AGGGTCAGAAAGATGTAACAAGG + Intergenic
1082563996 11:54653708-54653730 AGGGTCAGAAAGATGTAACAAGG - Intergenic
1083539101 11:63499451-63499473 ATGGTGAGAAAATTATGACAGGG + Intergenic
1086230025 11:84556987-84557009 AGAGGCAGACAGATATGACCCGG - Intronic
1086544721 11:87954337-87954359 AGGGAGAGACAGAGAGGAGATGG - Intergenic
1089126969 11:116183338-116183360 AGGGGAAGGCAGAAATGACAGGG + Intergenic
1090538898 11:127678646-127678668 AGGGTGGGACACATATGATGAGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092278527 12:7081305-7081327 AGGGAGAGACAGGGAAGACAAGG + Intronic
1092890819 12:12967760-12967782 AGGGAGAGACTGAAATAACAAGG + Intergenic
1092938144 12:13383137-13383159 ATGGTGAGAGAAATCTGACATGG + Intronic
1094527711 12:31243446-31243468 AGGGAGCCACAGATATGACTGGG + Intergenic
1096287536 12:50313448-50313470 AGGGTGAGACAACTCTGACAGGG - Intergenic
1098504663 12:71235828-71235850 AGGGACAGACAGATATGGAAAGG - Intronic
1101495966 12:105254330-105254352 AGGGGGAGAAAGATACGACCAGG - Intronic
1102152694 12:110699550-110699572 AGGGAGAGACAGAGAAGACGAGG + Intronic
1103499622 12:121391211-121391233 AGAGTGAGACAAATAACACAGGG - Intronic
1104427630 12:128691314-128691336 AGTGAGAGACTGAGATGACATGG - Intronic
1104611487 12:130232128-130232150 AGGGTGAGACAGAAAGAGCAAGG - Intergenic
1106359217 13:29014569-29014591 AGGCTGGGAAAGAAATGACAAGG + Intronic
1108081755 13:46744498-46744520 AGGGAGAGACACTTATGAAATGG + Intronic
1111392897 13:87622539-87622561 AAGGTGAGAGAGATATAAAAGGG - Intergenic
1113093145 13:106635875-106635897 ATGGTGAGACACAGATGCCACGG - Intergenic
1115545825 14:34463975-34463997 AGGGTGAGACAGACATTCTAAGG + Intergenic
1116674179 14:47884176-47884198 AGGGAGAGAGAGGTATGAGACGG + Intergenic
1117445520 14:55800445-55800467 ATGGTGAGAGAAATCTGACATGG + Intergenic
1119137028 14:72230453-72230475 AGGATGAGAGAGAGATCACAAGG + Intronic
1119877682 14:78074687-78074709 AGAGTGAGACAGACATGCCAAGG + Intergenic
1120408051 14:84114114-84114136 AGGCTGAAACAGAAATGAAACGG + Intergenic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1121785058 14:96652085-96652107 AAAGTGAGACAAATATCACAAGG - Intergenic
1124089500 15:26584874-26584896 TGGGTGAGAGATACATGACATGG + Intronic
1130026966 15:80278420-80278442 AGAGTGAGACAGAAGGGACAGGG - Intergenic
1133443487 16:5840216-5840238 AGGCTGAGACTGAGATGCCAAGG - Intergenic
1133519747 16:6545447-6545469 AGGCTGCAACAGAAATGACATGG - Intronic
1134027377 16:10964556-10964578 AGGGTCTGGCAGATAGGACATGG + Intronic
1134491747 16:14701008-14701030 AGTGTGGGACAGATAGGCCAGGG - Intergenic
1134497128 16:14740126-14740148 AGTGTGGGACAGATAGGCCAGGG - Intronic
1137232023 16:46575136-46575158 AAGTAGAGACAGAGATGACATGG + Intergenic
1137939358 16:52668208-52668230 ACAGTGAGAAAGACATGACATGG - Intergenic
1139308081 16:66005155-66005177 AGGATGGAACAGAGATGACATGG + Intergenic
1141267099 16:82507334-82507356 AGGGCCACACAGATATCACAGGG - Intergenic
1148715503 17:49712840-49712862 AGGGTGAGACAGATATGACAAGG - Intronic
1150221975 17:63500895-63500917 AGGCTGAGGGAGATGTGACATGG - Intronic
1150771000 17:68040844-68040866 AGGGACAGACAGATAGTACAAGG + Intronic
1152202842 17:78957016-78957038 AGAGTGGGACAGAGATGAGACGG - Intergenic
1153392541 18:4578615-4578637 TGCGTGAGACAAGTATGACATGG - Intergenic
1153392546 18:4578652-4578674 TGCGTGAGACAAGTATGACATGG - Intergenic
1153392551 18:4578689-4578711 ACTGTGAGACAAGTATGACATGG - Intergenic
1153755309 18:8276647-8276669 GTGGTGACACAGATATGAGATGG - Intronic
1159780252 18:72652701-72652723 ATGGTGAGATAGATAGGAGAGGG - Intergenic
1160980417 19:1814071-1814093 AGGGGGAGGCAGACATCACATGG + Intergenic
1162233860 19:9289489-9289511 AGGGTGGAACAGGTATGATAAGG + Intergenic
1162653523 19:12110253-12110275 TGGGTGAGACTGATATCACTGGG - Intronic
1164950713 19:32334518-32334540 AGGGAGAGACAGTGAGGACACGG + Intergenic
1165449925 19:35876259-35876281 AGGGTCATATAGAAATGACATGG - Intronic
1166863745 19:45823973-45823995 AGGGTGAGACTGAGGTGACAGGG + Intronic
1167031907 19:46967935-46967957 AGGGCGTGACAGACATGGCAGGG - Intronic
1167708246 19:51094483-51094505 AGGGTGAGGCAGAGAGCACAGGG - Intergenic
924989072 2:295700-295722 ATGCTGAGACAGAGATGAGATGG + Intergenic
925720824 2:6825121-6825143 AGAGTCAGACAGACATGAGATGG + Intergenic
926707013 2:15844156-15844178 AGGGAGAGACAGAGATGCCTTGG - Intergenic
927423600 2:22957341-22957363 AAGGACAGGCAGATATGACAGGG + Intergenic
927451905 2:23215928-23215950 ATGACGAGGCAGATATGACAGGG + Intergenic
927866855 2:26594412-26594434 TGGGTGAGGCAGAAATGAGATGG + Intronic
928409187 2:31041246-31041268 TGGGTGAGGAAGATATGAGAAGG + Intronic
932830151 2:74981472-74981494 ACAGTGAGACAAATATGGCATGG - Intergenic
936485459 2:112921677-112921699 AGAGTGAGAAAAATAAGACAGGG - Intergenic
938995458 2:136673146-136673168 ACGGTCACACAGATATTACATGG - Intergenic
939091592 2:137786464-137786486 AGGGTGAGAGAAATCTAACATGG + Intergenic
939697437 2:145343932-145343954 AGGGGCATACAGATATGCCATGG - Intergenic
939889846 2:147723435-147723457 AGGGAGAGAAAGAGAAGACAGGG + Intergenic
943259299 2:185638410-185638432 AGAGTGAGACAAATAAAACAAGG + Intergenic
944141326 2:196460002-196460024 AGGGTGAGAAGAATAAGACAGGG - Intronic
947616029 2:231557446-231557468 AGGGTGAGAGAGTTAGGAAAGGG - Intergenic
948316020 2:237029105-237029127 GGGGTGAGACCGATGTTACAAGG - Intergenic
1169557489 20:6766807-6766829 TGGGTGAGATAAATATCACAAGG + Intergenic
1170927369 20:20737564-20737586 AGGATGAGAGAGGTATGAGAAGG + Intergenic
1172782674 20:37446547-37446569 AAGGGGAGACAGATGTGCCATGG - Intergenic
1174993307 20:55537502-55537524 TGGGAGGGACAGATATGACGAGG - Intergenic
1175533274 20:59689383-59689405 AGAGTGAGACAGAAATGGCAGGG + Intronic
1177180143 21:17736151-17736173 AGGGTGAACCAGATCTAACAGGG - Intergenic
949831274 3:8217250-8217272 TGGGTGAGAAAGAAATCACATGG - Intergenic
949915966 3:8964847-8964869 AGGGAGAGAGAGAAAAGACAGGG + Intergenic
950258070 3:11522104-11522126 AGGGATAGACAGATCTGAAACGG - Intronic
950863639 3:16171968-16171990 AGGGTGAGAAAGAGAGGAGAAGG + Intergenic
951579150 3:24143712-24143734 AGGGGGAGAAAGATGAGACAAGG + Intronic
952036992 3:29214820-29214842 AAGGTTAGAGAGAAATGACAAGG + Intergenic
952650275 3:35718468-35718490 AGGGTGATATAGATAAAACATGG + Intronic
952668458 3:35936760-35936782 AGGGTGAGAAAGACTTGAAAAGG + Intergenic
953152811 3:40340700-40340722 AGGCAGAGACTGAGATGACAAGG + Intergenic
954360257 3:50118462-50118484 AGAGAGAGAGAGAGATGACAAGG + Exonic
954946317 3:54427769-54427791 AAGGTCAGACAGGTAGGACATGG + Intronic
955353187 3:58209229-58209251 AGGGTGAGGCAGCCTTGACAAGG + Intronic
956576760 3:70760656-70760678 TGGGTGAGATGGAAATGACAAGG + Intergenic
956610184 3:71114699-71114721 AGGGAGAGACAGATTCGACAAGG + Intronic
957973870 3:87418508-87418530 GGGGTGAGACAGGAATAACAAGG - Intergenic
959651628 3:108756404-108756426 AGGGTGATACAGACCTGACATGG + Intronic
962271309 3:133979880-133979902 AGGGTGTTGAAGATATGACAGGG + Intronic
964372635 3:156016930-156016952 AGGGGTAGACAGAAAGGACATGG - Intergenic
964430495 3:156600829-156600851 AGGGTGAGGCAAATGAGACAAGG - Intergenic
965334615 3:167421004-167421026 AGAGAGAGACAGAAATGAGAAGG + Intergenic
966217066 3:177514876-177514898 ATGTTGAGAGAAATATGACAGGG + Intergenic
966974596 3:185072958-185072980 TGGTTGAGGCAGATATGAGAGGG - Intergenic
967228100 3:187312425-187312447 AGAGAGAGACAGAGATGGCATGG - Intergenic
971723705 4:30281040-30281062 AGAGTGAGGCAGATATGATTTGG + Intergenic
972967165 4:44524666-44524688 AGGGTGAGACAGATATGGATAGG - Intergenic
973141374 4:46772621-46772643 AGGGAGAGAAAGAAATGCCAAGG + Intronic
973184733 4:47312271-47312293 AGCGTGAGACATAAATGATAAGG - Intronic
973634261 4:52847301-52847323 AGTGGGAGACAGTTATGAGAAGG + Intergenic
974057889 4:57002757-57002779 AGGATGAGACACAAATGAGAAGG + Intronic
974113186 4:57549122-57549144 TGTGTTAGACAAATATGACATGG + Intergenic
975055029 4:69919358-69919380 ATGGAGTGACAGATATGTCAAGG - Intergenic
977411400 4:96670645-96670667 AAAGTGAGACATAAATGACAGGG - Intergenic
982808346 4:159794398-159794420 AAGGTGATACAGATGTGGCATGG + Intergenic
984042071 4:174747387-174747409 AAGGTGAGACAGATTATACAGGG + Intronic
985218190 4:187675156-187675178 TGGGTGGGACAGATATGGGAGGG + Intergenic
986950765 5:13081337-13081359 AGGGTGAGCCAGGCATGAAATGG - Intergenic
987686828 5:21215375-21215397 AAGGAGAGACAGAGAAGACAAGG + Intergenic
987845287 5:23276030-23276052 AGGGAGCGAGAGAAATGACAGGG - Intergenic
988020998 5:25621314-25621336 AAAGGGAGAAAGATATGACAGGG + Intergenic
989158518 5:38367755-38367777 AGGCTGAGAAAGAGATGACCAGG - Intronic
990595886 5:57312063-57312085 AAGGTTAGAGAGGTATGACAGGG - Intergenic
990637544 5:57746372-57746394 AGCTAGAGGCAGATATGACAGGG - Intergenic
992776260 5:80091792-80091814 AGGGTGAGATAAACATGGCACGG - Intergenic
993611570 5:90060756-90060778 AGGCTGAGGTACATATGACAGGG - Intergenic
993881253 5:93364310-93364332 AGAGTGAGAAAGATAGGAAATGG - Intergenic
995463085 5:112422608-112422630 AGGGTGAGACAGAAATATTAAGG + Intergenic
995767051 5:115629862-115629884 AGAATGAGACAGAAGTGACAGGG - Intronic
999964683 5:156796722-156796744 AGGGGCAGACAGTTATGCCAAGG + Intergenic
1000357141 5:160409811-160409833 GGGGAGAGACAGATAGGATAAGG + Intronic
1001295601 5:170496743-170496765 CGGGTGAGACTGAAATGACGGGG - Intronic
1005620768 6:27618003-27618025 AGGGTGAGACAGTAAAGAAAGGG - Intergenic
1005869625 6:29965119-29965141 AGTGTGAGACAGAAAGGAAATGG + Intergenic
1006909706 6:37555964-37555986 AGGGAGAGAAAGAAAAGACAGGG - Intergenic
1007391086 6:41549708-41549730 TAGGAGAGACAGATATCACATGG + Intronic
1009549418 6:65068267-65068289 AGGGTGTGACTGATGTGAAATGG - Intronic
1011402188 6:86975537-86975559 AGGGTGACAAGGATATCACAGGG - Intronic
1013824460 6:114194852-114194874 AGGGTGGGACAAATAGGACAGGG - Intronic
1014031694 6:116712961-116712983 AGGGTGAGACAGATATGTATAGG - Intronic
1014398156 6:120952858-120952880 AGGGTTAGATACATATGAAACGG + Intergenic
1019346187 7:531830-531852 GGGGTGAGACAGAGAGGAGAGGG + Intergenic
1022338258 7:29443741-29443763 GGGGTGAGAGAGAGATGGCAGGG + Intronic
1022520959 7:31006621-31006643 AGGGAGACACAGATATTTCATGG + Intergenic
1022673969 7:32481027-32481049 TGGGATGGACAGATATGACAGGG + Intergenic
1023272542 7:38480287-38480309 AGGGTGAGGCAGGTGAGACAGGG + Intronic
1024006311 7:45226991-45227013 ATGGTGAGAAAGATGGGACATGG - Intergenic
1026606444 7:71820067-71820089 AGAGTAAGACTGATAGGACAAGG + Intronic
1027745035 7:82062236-82062258 ACAGTGAGACAAATCTGACATGG - Intronic
1027765727 7:82339068-82339090 AGGGAGAAACTTATATGACAAGG - Intronic
1030569071 7:111198813-111198835 AGAAAGAGAAAGATATGACAAGG - Intronic
1032134381 7:129262246-129262268 AGGGTTAGAAAAATAAGACAGGG + Intronic
1032153929 7:129453096-129453118 AGGCTGACATAGGTATGACAGGG - Intronic
1032587157 7:133157365-133157387 AGAGGGAGAAAGATATCACAGGG - Intergenic
1032979898 7:137269426-137269448 AACATGAGACAGATCTGACAGGG - Intronic
1034228300 7:149499395-149499417 AGGCTGAGTCGGATATGCCAGGG + Intergenic
1034312114 7:150097926-150097948 AAATTGAGACACATATGACATGG + Intergenic
1034794741 7:154002732-154002754 AAATTGAGACACATATGACATGG - Intronic
1034940247 7:155226088-155226110 AGAGTGAGACAGAGAGAACAAGG + Intergenic
1040994227 8:53385590-53385612 AGGGAGAGACACATAGGTCAGGG - Intergenic
1041279332 8:56195620-56195642 GGGGTGAGACAGATGTGAGGAGG + Intronic
1043611686 8:82071457-82071479 AGCGTGATACAGATAAGGCAAGG - Intergenic
1043804796 8:84658267-84658289 AGGGTCAGAAGAATATGACAGGG - Intronic
1045406974 8:101876259-101876281 AGGGTGAAGCATAAATGACAAGG + Intronic
1046289403 8:112137177-112137199 AGTCTGGGACAGCTATGACAAGG + Intergenic
1052236374 9:26215922-26215944 AGCGGGAGACAGAGATGACGAGG + Intergenic
1054888382 9:70224247-70224269 AAGGTGAGAGAGATATGAAAGGG + Intronic
1055374621 9:75635687-75635709 AAGGTGTTACAGCTATGACACGG - Intergenic
1055413874 9:76062329-76062351 CATCTGAGACAGATATGACAGGG + Intronic
1057835209 9:98439019-98439041 AGGGTGGCACACGTATGACAAGG - Intronic
1057974600 9:99591359-99591381 GGGGTGAAACAGATATTTCATGG + Intergenic
1059051284 9:110929125-110929147 AGGGTGACACAGCAATAACAGGG - Intronic
1060372440 9:123087166-123087188 AGGGTGAGGCAGCTATAATAAGG + Intronic
1061582109 9:131544579-131544601 AGGGAGGGACAGATATGCCCAGG - Intergenic
1061996627 9:134189428-134189450 AGGGAGAGAGAGAGATGACAGGG + Intergenic
1062657800 9:137613222-137613244 AGGGTGAAACAGCTGTGCCAGGG - Intronic
1185521689 X:745000-745022 AAGGTGACACAGGTATCACATGG + Intergenic
1185619477 X:1444672-1444694 AGGGAGAGAGAGAAAGGACAGGG - Intronic
1192111801 X:68372521-68372543 AGAATGAGAGAGATAGGACAGGG - Intronic
1192233598 X:69282473-69282495 AGGGTCACACAGATAAGAAAAGG + Intergenic
1194659922 X:96619270-96619292 AGAGAGAGACAGATATGAGTGGG - Intergenic
1194747294 X:97642013-97642035 AGGATTAGAGAGCTATGACATGG - Intergenic
1194764427 X:97832913-97832935 AGGGAGATACAGATATGGAAAGG - Intergenic
1195619722 X:106940956-106940978 TGAGTGGTACAGATATGACATGG - Exonic
1197154741 X:123258153-123258175 AGGTTGAGACAGAGATGTTAAGG - Intronic
1197826296 X:130594030-130594052 AGGGAGAGAAAGAGATGAGAGGG - Intergenic
1198480022 X:137032730-137032752 AGGGAGAGACAGAAACCACACGG - Intergenic