ID: 1148715660

View in Genome Browser
Species Human (GRCh38)
Location 17:49713947-49713969
Sequence GCGTCCTAGAGACTCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148715656_1148715660 7 Left 1148715656 17:49713917-49713939 CCACGTGGTGGGTGTGTTTGGGA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1148715660 17:49713947-49713969 GCGTCCTAGAGACTCCACAGTGG 0: 1
1: 0
2: 1
3: 8
4: 100
1148715654_1148715660 8 Left 1148715654 17:49713916-49713938 CCCACGTGGTGGGTGTGTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1148715660 17:49713947-49713969 GCGTCCTAGAGACTCCACAGTGG 0: 1
1: 0
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148715660 Original CRISPR GCGTCCTAGAGACTCCACAG TGG Intronic