ID: 1148717427

View in Genome Browser
Species Human (GRCh38)
Location 17:49725774-49725796
Sequence ACGTTTTTGCAGATGTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148717425_1148717427 2 Left 1148717425 17:49725749-49725771 CCTATAAATGTTACCTTGTATAG 0: 1
1: 1
2: 7
3: 68
4: 406
Right 1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG 0: 1
1: 0
2: 1
3: 14
4: 177
1148717424_1148717427 18 Left 1148717424 17:49725733-49725755 CCTCAAAGATGAGGAACCTATAA 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG 0: 1
1: 0
2: 1
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148717427 Original CRISPR ACGTTTTTGCAGATGTATTA AGG Intronic
902086546 1:13867268-13867290 AGGTCTTTGCAGATGTAGTCAGG - Intergenic
906866468 1:49426254-49426276 ACATTATTGCAGCTGGATTATGG + Intronic
910031975 1:82737299-82737321 ATGTTTATGCAGATGTGCTAGGG - Intergenic
910063581 1:83124196-83124218 ATTTTTTTGCAGATGTACTTAGG - Intergenic
911286492 1:96000038-96000060 AAGTTCTAGCAGATGTAATAAGG + Intergenic
911882028 1:103251934-103251956 AGGTTTTTGCAGAGGTAATCAGG - Intergenic
912007725 1:104925171-104925193 CCGTTTTTCCAGATTTATAATGG + Intergenic
918026253 1:180750470-180750492 ACATGTTTGCAAATATATTAAGG + Intronic
918640043 1:186828895-186828917 GCGCTTTTGCAGATGTTTTAAGG - Intergenic
918955057 1:191197485-191197507 AAGTTCTTGCAGGTGTATTGTGG + Intergenic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
919227951 1:194732545-194732567 AAGGTTTTTCAAATGTATTAGGG + Intergenic
920974776 1:210775513-210775535 ACGTGTTTGGAGATGTGTTCTGG - Exonic
923043758 1:230338974-230338996 TGGATTTTGCAAATGTATTATGG - Intronic
923979457 1:239304790-239304812 ATGTATTTGCAGATGGCTTAAGG + Intergenic
1066556880 10:36623947-36623969 AAGATTTTGCTCATGTATTAGGG + Intergenic
1068900427 10:62263155-62263177 AGGGTTTTGCAGATGTAATTAGG + Intronic
1069403801 10:68076795-68076817 AGTTCTTTGCAGATGTAATAAGG - Intergenic
1074170437 10:110928944-110928966 AAGTTTTTTCATATGCATTAAGG - Intronic
1077446879 11:2598622-2598644 AGAATTTGGCAGATGTATTAGGG - Intronic
1081501350 11:43669807-43669829 AGGTCTTTGCAGATGTAATCAGG - Intronic
1082636619 11:55602879-55602901 ACCTTATTGCAAATGCATTAGGG + Intergenic
1086138402 11:83466457-83466479 ACATTATTGAAGATGTTTTAAGG + Intronic
1087572408 11:99945728-99945750 ACGTTTTTGCATTGGTATAAAGG + Intronic
1091528268 12:1328442-1328464 ACGTGTTTTCAAAAGTATTAAGG - Intronic
1092756061 12:11764603-11764625 AAGATCTTGCAGATGTATAAAGG + Intronic
1095701978 12:45200090-45200112 ATGCTTTTGCTGATGTATTATGG - Intergenic
1095787523 12:46126330-46126352 ACATTTTTACAGCTGTCTTATGG - Intergenic
1097769252 12:63562089-63562111 TTTTTTTAGCAGATGTATTAAGG + Intronic
1099509519 12:83516978-83517000 ATGTTCTTGCAGATATATTTTGG + Intergenic
1101046182 12:100808660-100808682 ACATATTTGCAGAGGTATTGAGG + Intronic
1102070018 12:110010916-110010938 ACATTTTCTAAGATGTATTATGG + Intronic
1102889039 12:116543865-116543887 GGGTTTTTGCAGATGTAATTAGG - Intergenic
1107260176 13:38481160-38481182 ATGCTTTTGCAGTTGTATGATGG - Intergenic
1107260380 13:38483382-38483404 AAGTTTGAGCAGGTGTATTAGGG - Intergenic
1107340097 13:39396418-39396440 AGGTTGTTGCAGATGTAATTAGG + Intronic
1107768537 13:43764239-43764261 ATGTTTTTGTAGATGTTTCAGGG - Intronic
1110750764 13:79112962-79112984 AAGTTTTTCAATATGTATTAAGG - Intergenic
1111073008 13:83194321-83194343 ACATTTTTTCATATGTATTTTGG - Intergenic
1112097844 13:96153996-96154018 ACGTTTTCTCAGTTGTAATATGG + Intronic
1112113099 13:96324188-96324210 AAGTTTTTGGAGATGTTTAAAGG - Intronic
1112258351 13:97855249-97855271 AATTTTTTCCAGATTTATTAAGG - Intergenic
1113360049 13:109622479-109622501 AAGTCTTTGCAGATGTAATTGGG + Intergenic
1113636429 13:111921929-111921951 ACAGTTTTACAGAAGTATTAGGG - Intergenic
1113696529 13:112349996-112350018 ACGTGTTTGCATATGTGTGAGGG - Intergenic
1117098434 14:52320921-52320943 ACGTTTTTGCAAATGAATTCAGG - Intronic
1118291950 14:64534918-64534940 ACATTTTTGCAGAATTACTAGGG - Intergenic
1119672674 14:76531325-76531347 GTGTCTTTGCAGCTGTATTAAGG - Intergenic
1120351264 14:83361881-83361903 ACATTATTGCAGATGCATAATGG - Intergenic
1121211717 14:92212309-92212331 AGGTATTTGCAGATGTAATTCGG + Intergenic
1121998685 14:98627834-98627856 AGGTCTTTGCAGATGTAATCAGG + Intergenic
1125632225 15:41156602-41156624 TAGTTTTTACAGATGTATCATGG + Intergenic
1125655298 15:41351821-41351843 ATTTTTTTTCAGATGTATTAAGG - Intronic
1127144382 15:56009503-56009525 ACGTTCTTGCACATGTCTTTTGG + Intergenic
1127160485 15:56178922-56178944 AAGTTTTTGAAGATGTTTAATGG - Intronic
1127417672 15:58772562-58772584 ACTTTTTTGCATATGTGATAAGG - Intronic
1127705655 15:61545087-61545109 ACATTTTGGCAGATATTTTAAGG + Intergenic
1129098713 15:73237509-73237531 AAGCTTTAGCTGATGTATTAGGG - Intronic
1129204378 15:74027122-74027144 ACCTTTTTGCAGCTGCATAATGG + Intronic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1131783753 15:95888747-95888769 ACTTTATTGAAGATGTTTTAGGG + Intergenic
1138862669 16:60776982-60777004 AAGTTTTTGGAGATGTGTGACGG + Intergenic
1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG + Intergenic
1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG + Intronic
1149096547 17:52847859-52847881 ACATATTTGTACATGTATTAGGG - Intergenic
1149808824 17:59646399-59646421 AAATTTTTGCACATGTGTTACGG + Intronic
1153194293 18:2576377-2576399 ACGTTTTTGCAAATCTCTTATGG + Intronic
1155377444 18:25175785-25175807 ACGGTTTTGCTACTGTATTATGG + Intronic
1155471924 18:26200600-26200622 ACCCTTTTGCCTATGTATTAAGG + Intergenic
1156756370 18:40531628-40531650 ACGTTCTTGGAGAGGTCTTATGG - Intergenic
1159547800 18:69862226-69862248 ACATTTTTACAGTTGTAGTATGG - Exonic
1163063886 19:14779018-14779040 ACATCATTGCAGATGTTTTAAGG - Intergenic
1164287422 19:23831402-23831424 AATTTTTTACAGATGTATTTGGG + Intergenic
1168384920 19:55955148-55955170 AAGTATTTCCAGATGTATTTTGG + Exonic
925002053 2:410899-410921 ACCTTTTTCCAGATTTATTGAGG + Intergenic
925765206 2:7227081-7227103 ACATTGTTTGAGATGTATTAAGG + Intergenic
926521469 2:13920993-13921015 ACATTTTTGAAGTAGTATTAAGG + Intergenic
934872435 2:97879351-97879373 ACTTTCCTGCAGATATATTATGG + Intronic
935208560 2:100919294-100919316 ACGTTTTAGCACATGTATAAAGG - Intronic
935209584 2:100927292-100927314 TCGTTTTTGTAGATGTCGTAAGG + Intronic
935469552 2:103440936-103440958 TTATTTTTGCAGATGTATTTTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
939319788 2:140604314-140604336 ATGTTTTTGCAGAAGAAATAAGG + Intronic
939793411 2:146609940-146609962 ATTTTTTTTCAGCTGTATTAAGG + Intergenic
940464117 2:154006997-154007019 GAGATTCTGCAGATGTATTAAGG + Intronic
941117874 2:161492595-161492617 AGGTTTTTGCTGTTGAATTAAGG + Intronic
941687920 2:168466629-168466651 ACATTCTTACAGATGAATTACGG - Intronic
942134796 2:172914232-172914254 ATGTGTTTGCATATGTATTCAGG + Intronic
942863616 2:180645989-180646011 AATTTTTTTCAGCTGTATTAAGG + Intergenic
943271871 2:185815723-185815745 AAGTATTTGCTAATGTATTAGGG + Intronic
948507810 2:238441806-238441828 ATAGTTTTGCAGATGTATTTTGG + Intronic
1169393983 20:5213720-5213742 AAGTTTTTGCTGATGCTTTAGGG + Intergenic
1170669035 20:18413314-18413336 ATATATTTGCATATGTATTAGGG + Intronic
1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG + Intergenic
1174909910 20:54596350-54596372 AAGTTTTTGCAGATGCATGTTGG - Intronic
1176038968 20:63054521-63054543 AGGTCTTTGCAGATGTAATTAGG - Intergenic
1176692653 21:9934691-9934713 ACATTTTTGCAGAAATGTTAAGG - Intergenic
1179119307 21:38528221-38528243 GGGTTATTGCAGATGTAGTAGGG - Intronic
954059879 3:48058141-48058163 ACTTTTTTGCACTTGTTTTAAGG - Intronic
955100406 3:55843709-55843731 ACATTTTTGCAGTGGGATTAAGG - Intronic
955231020 3:57098729-57098751 AAGTTTTTGCAGAGGGACTAGGG - Intronic
955272026 3:57510146-57510168 ATGTTTTGGGAGATTTATTAGGG - Intronic
955468634 3:59262955-59262977 ATGTTTTTGATGGTGTATTAGGG + Intergenic
957124012 3:76134453-76134475 GGGATTTTGCAGATGTATTAAGG + Intronic
957596133 3:82269152-82269174 ACTTTTTTTCAGATGTTTTTTGG + Intergenic
957637074 3:82800226-82800248 ATATTTTTCCAGATGTATTCAGG + Intergenic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
964065817 3:152577461-152577483 ATTGTTTTGAAGATGTATTAGGG - Intergenic
969163812 4:5286757-5286779 ACATTTTTGCATATGTATTTTGG + Intronic
970232302 4:13923202-13923224 GGGTTTTTGTAGATGTAATAAGG - Intergenic
970294147 4:14610366-14610388 ACTCTTTTGCAGATGGATTGTGG + Intergenic
972248262 4:37269633-37269655 AAGGTTTTGAAGATTTATTATGG + Intronic
972887689 4:43512565-43512587 ATGTTTTTGCAAGTGTATTTTGG + Intergenic
973291444 4:48474916-48474938 ACTGTTTTGCAGATGTAGTGGGG + Intergenic
973801000 4:54478278-54478300 ACAATATTGCAGATGTATTTTGG + Intergenic
974335106 4:60533245-60533267 AGGATTCTGCAAATGTATTATGG - Intergenic
975265284 4:72357303-72357325 ATATTTTTGTACATGTATTATGG - Intronic
976785355 4:88813566-88813588 ACCTTATTGCAAATTTATTAAGG + Intronic
979107865 4:116710474-116710496 AGCCTTTTGCAGATGTAATAGGG + Intergenic
979340550 4:119517629-119517651 ACGTTTCTCCAGATGTTTTTGGG + Intronic
979936497 4:126704017-126704039 ACCTTTTTCCAGCTTTATTAAGG + Intergenic
980490639 4:133522970-133522992 AGGTTTTTGCAGATACATTTGGG - Intergenic
981447178 4:144853471-144853493 ACGTTTTTGTACATGTCTTTTGG - Intergenic
982423267 4:155223301-155223323 AGGTTGTTGCAAAAGTATTATGG + Intergenic
986134373 5:4960434-4960456 AGGTCTTTGCAGATGTAATTAGG - Intergenic
987335098 5:16891759-16891781 ACCTTCTTGCATATGTAATAAGG - Intronic
987537568 5:19208328-19208350 ACGTGTTACCAGATGTATTGGGG - Intergenic
987571318 5:19664580-19664602 ACGTCTTTGCATATATATTTGGG - Intronic
988028764 5:25735038-25735060 ACTTTTTCCCAGATTTATTAGGG - Intergenic
989182390 5:38591581-38591603 AGGTTTGTGCAGATGTTTGAAGG + Intronic
989354525 5:40528524-40528546 AAGTTTTTGCATATTAATTAGGG + Intergenic
993452071 5:88084353-88084375 GAGTTTTTGCAGATGTAATTAGG + Intergenic
993705887 5:91169793-91169815 AGGGTTTTGCAGATGTAATTAGG - Intergenic
993994402 5:94704283-94704305 ACGTTTTTCAAGAAGTATAATGG + Intronic
995213982 5:109573668-109573690 ACATTTTTTCAGATTTATTTTGG - Intergenic
1004489531 6:16101029-16101051 AAGTCTTTGCAGATGTAATCAGG - Intergenic
1005437237 6:25827711-25827733 GGGGTTTTGCAGATGTATTATGG - Intronic
1006764826 6:36495608-36495630 ACAGTTTTTCAGATGCATTATGG + Exonic
1009869556 6:69436281-69436303 AAGATTTTGCAGATGTATTAAGG + Intergenic
1010863947 6:80949152-80949174 ATGTTTCTGCTGATGTATTAGGG + Intergenic
1011018604 6:82786131-82786153 ACATCTGTGCAGAAGTATTAGGG + Intergenic
1014357374 6:120429765-120429787 ACATTTTGGCAGATGCTTTATGG + Intergenic
1014790934 6:125671042-125671064 ACCTCTTTGCAGATGTCTTCTGG - Intergenic
1018250216 6:161862140-161862162 GCGTCTTTGCAGATAAATTAAGG - Intronic
1019047248 6:169158689-169158711 ACCATTTTGTAGATGTATTCGGG + Intergenic
1020508827 7:9026597-9026619 ACCTTTTTTCAGATTTATTAGGG + Intergenic
1020850019 7:13341179-13341201 ACATTTTTTCATATGTATTTTGG + Intergenic
1021308773 7:19065335-19065357 ACTTTTTTTCATATTTATTAGGG - Intronic
1021362164 7:19728842-19728864 AAGTGTTTTCAGATGTTTTATGG - Intronic
1021380906 7:19965013-19965035 ATTATTTTGCAGCTGTATTAAGG + Intergenic
1022367659 7:29740699-29740721 TTTTTTTAGCAGATGTATTAAGG - Intergenic
1022637111 7:32146603-32146625 GGGTCTTTGCAGATGTATTTAGG - Intronic
1022683624 7:32573803-32573825 ATGTTTTTTAAGATGTATAAAGG + Intronic
1022928523 7:35083168-35083190 TTTTTTTAGCAGATGTATTAAGG + Intergenic
1024977132 7:55124299-55124321 AGGTTTTTGGAGAGGTATTTTGG + Intronic
1029824636 7:103176841-103176863 TTTTTTTAGCAGATGTATTAAGG + Intergenic
1029838079 7:103334259-103334281 ACGTTTTTGCAGAAATCTTTTGG + Intronic
1031264219 7:119564223-119564245 AAGCTTTTGCTGATGTTTTATGG - Intergenic
1032983611 7:137313326-137313348 ACTGTTTTGCAGATGACTTAGGG + Intronic
1037166164 8:15831413-15831435 ACCTTTTTGGAAATGTAGTATGG - Intergenic
1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG + Intergenic
1045495953 8:102708772-102708794 AATTTTTTGCAGCAGTATTAAGG + Intergenic
1045650696 8:104339220-104339242 AGGTTTTTGCAGGTATAATAGGG + Intronic
1050731932 9:8718699-8718721 ACGTTTCTGCAGATGTAGGAAGG - Intronic
1052019149 9:23506191-23506213 TCTTTTTTTCAGATTTATTAAGG + Intergenic
1053629594 9:39920756-39920778 ACATTTTTGCAGAAATGTTAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053776172 9:41542791-41542813 ACATTTTTGCAGAAATGTTAAGG + Intergenic
1054214293 9:62329946-62329968 ACATTTTTGCAGAAATGTTAAGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054673191 9:67825412-67825434 ACATTTTTGCAGAAATGTTAAGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054934870 9:70676451-70676473 AGGTTTATGCTGATGTATGAGGG + Intronic
1056263863 9:84876655-84876677 ATTTTTTTCCATATGTATTAGGG + Intronic
1057532771 9:95867492-95867514 ACATTTTTGGATATGTATGAGGG + Intergenic
1058853000 9:109031253-109031275 ACGTTTTTGTACATGTCTTTTGG - Intronic
1058855484 9:109057859-109057881 ATGTCTTTGCAAATGTATTTAGG - Intronic
1060164499 9:121398883-121398905 ACTTTTTTGGACTTGTATTATGG + Intergenic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187413603 X:19072781-19072803 ATGTTTTTGGAGAAGTTTTATGG + Intronic
1187780057 X:22811083-22811105 ACATTCTTGCAGATATATTTGGG - Intergenic
1189422129 X:40865432-40865454 GCCTATTTGCAGATGTCTTAAGG + Intergenic
1189743965 X:44150869-44150891 GGGTTTTTGCAGATGTAATTAGG + Intronic
1190030784 X:46970826-46970848 ACGTTATTGTAAATGTATAATGG + Intronic
1193758180 X:85434498-85434520 GGGATTTTGCAGATGTATTAAGG - Intergenic
1194641466 X:96408362-96408384 ATGGTTTTGCTGGTGTATTAAGG - Intergenic
1195793171 X:108612400-108612422 AAATTTTTGTAGATTTATTAGGG - Intronic
1197514398 X:127407361-127407383 ACGTATATTCAGATGTAATAAGG - Intergenic
1199918501 X:152371101-152371123 AGATTTTTCCAGATATATTAAGG - Intronic
1201628108 Y:16037802-16037824 ACATTTATTCAGATGTATTTTGG - Intergenic
1201709494 Y:16974477-16974499 AGGTTTTTGAAGATGTATGTCGG + Intergenic