ID: 1148720270

View in Genome Browser
Species Human (GRCh38)
Location 17:49747530-49747552
Sequence ACTAGGATCTTTGATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148720270 Original CRISPR ACTAGGATCTTTGATCCTGA AGG (reversed) Intronic
907654942 1:56332875-56332897 ATGAGAATCTTTGAACCTGAGGG - Intergenic
908598158 1:65710687-65710709 CCTTTGATCTTTGATGCTGATGG + Intergenic
910042403 1:82868542-82868564 ACTAGGATTGTTTAGCCTGAAGG + Intergenic
910058661 1:83062531-83062553 ACTCCCATCTTTGATGCTGATGG + Intergenic
910168134 1:84349327-84349349 AGCAGCATCTTTGATCCTTAAGG + Intronic
912894752 1:113575333-113575355 CCTTTGATCTTTGATGCTGATGG + Intronic
913437147 1:118858962-118858984 AGTAGGATCTTTGATCATATTGG - Intergenic
913668808 1:121075313-121075335 ACTATGACCTTTGATGCTGCTGG - Intergenic
914020553 1:143862746-143862768 ACTATGACCTTTGATGCTGCTGG - Intergenic
914659051 1:149770664-149770686 ACTATGACCTTTGATGCTGCTGG - Intergenic
919799352 1:201344100-201344122 GCCAGGATCTTTGATCCACAGGG - Intergenic
920558535 1:206922261-206922283 ATAAGGCTCTTTTATCCTGAAGG - Intronic
1067175440 10:43942763-43942785 AGTAGGATCTTTCTGCCTGAAGG - Intergenic
1072553781 10:96498849-96498871 GCTTGGATCTTAGATCTTGAAGG + Intronic
1072852018 10:98905931-98905953 ACTAAGTTCTTCAATCCTGAAGG - Intronic
1074104313 10:110376979-110377001 ACCAGGAGCTCTGAGCCTGAAGG - Intergenic
1081118390 11:39233061-39233083 CCTTTGATCTTTGATGCTGATGG - Intergenic
1083507137 11:63168164-63168186 CCTTTGATCTTTGATGCTGATGG - Intronic
1084452468 11:69247915-69247937 GCTAGGATCTGTGATACAGAAGG - Intergenic
1084452622 11:69249008-69249030 GCTAGGATCTGTGATACAGAAGG + Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1092809037 12:12254823-12254845 TCTAGGATTTTTGAGCCTGCCGG - Intronic
1093516179 12:19989519-19989541 GCTGGGATCTTAGATCGTGATGG + Intergenic
1097532554 12:60822917-60822939 ACTATGAAATTTTATCCTGAAGG - Intergenic
1098562805 12:71896007-71896029 ACTAAGAACATTGATTCTGAAGG + Exonic
1099253608 12:80289043-80289065 CCTTTGATCTTTGATGCTGATGG + Intronic
1103688885 12:122754043-122754065 ACTAGGTTATTTCAGCCTGAAGG + Intronic
1105286194 13:19006867-19006889 CCTTTGATCTTTGATGCTGATGG + Intergenic
1113680471 13:112240214-112240236 AACAGGACCTTTCATCCTGAAGG + Intergenic
1120137381 14:80885624-80885646 CCTTTGATCTTTGATGCTGATGG - Intronic
1121723049 14:96125177-96125199 ACTAAGATATTTGAACCTTATGG + Intergenic
1126775646 15:52098508-52098530 ACTTGGGTCTTTGGTCTTGAAGG - Intergenic
1130567881 15:85013205-85013227 CTTAGCAACTTTGATCCTGATGG + Intronic
1130715475 15:86329504-86329526 ACTAGGATCTTTGCACAGGAAGG - Intronic
1133678741 16:8100296-8100318 ACTAGGATTTGTGTTCCTTATGG - Intergenic
1135250497 16:20897557-20897579 ACTTGAAACTTAGATCCTGATGG + Intronic
1140718195 16:77746035-77746057 ACTAGCATCTCTGATCTTCAAGG - Intergenic
1140807233 16:78544006-78544028 ACTAGAAGCTTTGAAACTGAGGG - Intronic
1141188634 16:81807376-81807398 ACTTGGATCTCAGATCCAGAAGG - Intronic
1141409033 16:83820022-83820044 ACTTGGGTCATTGATCCTGAAGG + Intergenic
1142721310 17:1777767-1777789 ACTAGGATCAGTGATCCTCCCGG + Intergenic
1144177708 17:12723079-12723101 ACTAGGATCTTTGGGGATGAGGG + Intronic
1148720270 17:49747530-49747552 ACTAGGATCTTTGATCCTGAAGG - Intronic
1150916438 17:69442368-69442390 CCTTGGATCCTTAATCCTGATGG + Intronic
1153302668 18:3605098-3605120 AATAGGAACTCTTATCCTGAGGG - Intronic
1155351150 18:24907654-24907676 TCAAGGATGTTTGTTCCTGAAGG - Intergenic
1155435299 18:25806330-25806352 ACTAGGTTCTTTCATCCCTAGGG + Intergenic
1156833013 18:41518197-41518219 ACAATGATCTTTGATATTGAAGG + Intergenic
1157675407 18:49564843-49564865 ATTAGGATGTTTGATCCAGGGGG + Intronic
1162418317 19:10551753-10551775 ACTAGGATGTCAGCTCCTGAGGG + Intronic
1165821151 19:38676938-38676960 ACTTGCAGGTTTGATCCTGAGGG - Intronic
1167995693 19:53400211-53400233 ACTTCGATATTTGATCCTGCTGG + Intronic
926980924 2:18567254-18567276 TCTAGGCTCTTTGTTCCTGAGGG - Intronic
929471194 2:42194806-42194828 GCCAGGATCTTTAATCTTGATGG + Intronic
931047363 2:58370758-58370780 ACCAGGATATGTGATCCTTAAGG - Intergenic
932068626 2:68592936-68592958 ACTGGCATCTTGGATCCTGGTGG + Intronic
932970103 2:76530564-76530586 AATAGGATCTTTGATGCTTGAGG - Intergenic
933742696 2:85547255-85547277 ATTTGGATCTTTGCCCCTGATGG - Exonic
936724608 2:115298042-115298064 AATAGAATCTTTAATCTTGAGGG - Intronic
936747574 2:115597078-115597100 AATGGGATCCTTGATTCTGAGGG - Intronic
939192501 2:138932281-138932303 TCTAGGATCTCTGATCTCGAGGG - Intergenic
939378489 2:141402087-141402109 ACATGGTTCTTTGAACCTGAGGG + Intronic
939621072 2:144419968-144419990 ACTAGGATCTAAGTCCCTGAAGG - Intronic
940410819 2:153360988-153361010 ACTGGGATCTCTGACCTTGAGGG - Intergenic
946063636 2:216967795-216967817 ACTATGTTCTTTGTTCCTAATGG - Intergenic
1170002012 20:11625329-11625351 CCTAGGATCATTTATCCTGATGG - Intergenic
1181542356 22:23580194-23580216 ACAAGGACCTCTGACCCTGAGGG - Exonic
950740212 3:15044818-15044840 AACAGGATGCTTGATCCTGAAGG + Exonic
951126834 3:18994859-18994881 ACTAGAATCTTTTGTCCAGATGG + Intergenic
953702514 3:45207744-45207766 ACCTGGAGCTTTGATCCTGATGG - Intergenic
955456937 3:59132611-59132633 ACTAGAATCTTTGCTCATCAAGG - Intergenic
957423455 3:80003113-80003135 ACTGGGATATTTTATCCTGTAGG + Intergenic
957833488 3:85553822-85553844 ATTGGGATCTTTGTTCCTGGAGG - Intronic
958634694 3:96728503-96728525 ACTAGATTCTTAGATCCTGGTGG + Intergenic
962064492 3:131964218-131964240 CCTTTGATCTTTGATGCTGATGG - Intronic
962742454 3:138371832-138371854 ACCAGGATCTGTGGTCATGATGG - Intronic
964391145 3:156199964-156199986 CCTTTGATCTTTGATGCTGATGG + Intronic
974655604 4:64816313-64816335 ACTTGGATCTTTCATTCTGAAGG + Intergenic
982086779 4:151843637-151843659 ATTAGAATTTGTGATCCTGAAGG + Intergenic
982585063 4:157225407-157225429 ACTAAGATTTTTTTTCCTGAAGG + Intronic
983727016 4:170941013-170941035 TCTGGGATCTCTGATCTTGAGGG - Intergenic
989113042 5:37925986-37926008 AACAGCATCTTTGATCCTGAGGG + Intergenic
998326820 5:141288316-141288338 ACTAGGGCCTTTCATCCAGAAGG - Intergenic
998754927 5:145366971-145366993 ATTAGGATATTTTATCCAGAAGG + Intergenic
999679860 5:154046804-154046826 ACTAGCTACTTTGATCCTGGGGG + Intronic
1000523601 5:162328013-162328035 TCTAGGATCTCTGACCTTGAGGG - Intergenic
1004786490 6:18973707-18973729 CCTAGAATGTTAGATCCTGAAGG - Intergenic
1004787961 6:18990143-18990165 ACGAGGATATTTTATCCTTATGG - Intergenic
1006135744 6:31895700-31895722 ACTTGAATCTTTGCTCCTAAAGG + Intronic
1006797051 6:36738567-36738589 CCTAGGGTCCTTAATCCTGAAGG + Intergenic
1010653924 6:78489170-78489192 ACTGGGTTCTTTTAACCTGAAGG + Intergenic
1011934067 6:92753525-92753547 ACTAAGATCTGTGACTCTGAGGG + Intergenic
1012214912 6:96571607-96571629 GCCAGGATCTATGATTCTGAGGG + Intronic
1013469727 6:110451419-110451441 AATAGGATCTCTCATCCTGCTGG - Intronic
1013923201 6:115435185-115435207 GGTAGCATCTGTGATCCTGAGGG - Intergenic
1014228846 6:118879637-118879659 ACTAGTATTTTTTATTCTGATGG - Intronic
1014484680 6:121984605-121984627 TCTGGGATCTCTGACCCTGAGGG + Intergenic
1015558622 6:134489830-134489852 AGTATGCTCTTTGATCATGATGG + Intergenic
1017452591 6:154567577-154567599 GCCAGGATCTTTATTCCTGAAGG - Intergenic
1020608498 7:10366878-10366900 CCTTTGATCTTTGATGCTGATGG + Intergenic
1022140655 7:27490968-27490990 AGTAGGAGCTTTTATTCTGATGG - Intergenic
1022615737 7:31927785-31927807 CCTTTGATCTTTGATGCTGATGG - Intronic
1027682181 7:81234604-81234626 ACAAGGATCAATAATCCTGATGG - Intergenic
1029202739 7:98849856-98849878 AGTAGGATCTCAGGTCCTGAAGG - Intronic
1030497079 7:110313953-110313975 ACTAGGAGCTCTGATGCCGAGGG - Intergenic
1031560879 7:123236656-123236678 ACTAAGATGTCTGAGCCTGAGGG - Intergenic
1040102848 8:43520536-43520558 ATGTGAATCTTTGATCCTGAGGG + Intergenic
1042299636 8:67263196-67263218 AATTGGATCTTTAAGCCTGAGGG - Intronic
1045116130 8:98982416-98982438 GCTAGGATCTTAGATCTGGAAGG + Intergenic
1046061364 8:109143732-109143754 ACTAGGATCACTGGTCCTAAGGG - Intergenic
1047076452 8:121409499-121409521 ACTAGGATCTTTGGTCCTCTGGG + Intergenic
1048004076 8:130404453-130404475 ATCATGATCTTTGATTCTGAAGG - Intronic
1049062196 8:140285425-140285447 ACAGGGATCCTGGATCCTGAGGG + Intronic
1055823778 9:80300421-80300443 CCTTTGATCTTTGATGCTGATGG + Intergenic
1056900451 9:90594529-90594551 ATTAGCATCTTAGATCCTGTTGG + Intergenic
1057232499 9:93332381-93332403 ACGAGGGTGTTTGTTCCTGAAGG - Intronic
1058423253 9:104853526-104853548 ACTTGGAGCTTTCATTCTGATGG - Intronic
1059640384 9:116211205-116211227 ACCAAGATCTCTGAGCCTGAGGG + Intronic
1060500049 9:124146383-124146405 TCTAGAATGTTTGAACCTGAGGG + Intergenic
1062161271 9:135081510-135081532 GCTGGGGTCTTTGATCCTCAGGG - Intronic
1186264161 X:7813696-7813718 ATTAGGAAATTTCATCCTGATGG - Intergenic
1186548517 X:10477381-10477403 GCTAGGAACTTTGATCCTTTTGG - Intronic
1189580734 X:42403661-42403683 GGTAGGATCTCTGAGCCTGATGG + Intergenic
1194954301 X:100161740-100161762 CCTTTGATCTTTGATACTGATGG + Intergenic
1197954257 X:131929744-131929766 ACTAGAATCGTAGATCCTCATGG - Intergenic