ID: 1148720921

View in Genome Browser
Species Human (GRCh38)
Location 17:49752597-49752619
Sequence TAACCATGACCACCCCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148720915_1148720921 5 Left 1148720915 17:49752569-49752591 CCCTAACATGGCCTTGCCCCAAG 0: 1
1: 0
2: 0
3: 14
4: 115
Right 1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 117
1148720917_1148720921 -6 Left 1148720917 17:49752580-49752602 CCTTGCCCCAAGCTCAGTAACCA 0: 1
1: 0
2: 1
3: 24
4: 264
Right 1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 117
1148720913_1148720921 21 Left 1148720913 17:49752553-49752575 CCATCTTCGCATGTCTCCCTAAC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 117
1148720916_1148720921 4 Left 1148720916 17:49752570-49752592 CCTAACATGGCCTTGCCCCAAGC 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148720921 Original CRISPR TAACCATGACCACCCCACAG AGG Intronic
905554864 1:38873952-38873974 TAACAATACCCACCCTACAGGGG - Exonic
906001610 1:42431196-42431218 TCTCCAGGACCACCCCAGAGTGG - Intronic
906357622 1:45120761-45120783 TCGCCATGCCCAGCCCACAGGGG + Intronic
909393475 1:75141432-75141454 TAACCATTCCCACCAAACAGGGG - Intronic
911266147 1:95745995-95746017 TAACCATAGCCATCCTACAGTGG + Intergenic
911653113 1:100411910-100411932 TCAGCATCACCACCCCAAAGAGG - Intronic
911866355 1:103028391-103028413 TATTCATGACCACCACACGGAGG - Intronic
918358367 1:183728422-183728444 GAACCCTGACCACTCCAAAGGGG + Intronic
923544314 1:234913202-234913224 AAGCCATCACCCCCCCACAGAGG + Intergenic
1064439729 10:15342962-15342984 TTACCATGCACACCCCACATTGG + Intronic
1070280615 10:75045543-75045565 TAAACACCACCTCCCCACAGTGG - Intronic
1073262252 10:102199492-102199514 TAACAGTGAGCACCCCACATCGG - Intergenic
1073267498 10:102236628-102236650 AAACCATGGCCTCCCCACTGTGG - Intronic
1075984663 10:126774245-126774267 TAACCCTGATGGCCCCACAGAGG - Intergenic
1076907841 10:133372435-133372457 TGACCAGGGCCACCCCTCAGAGG - Intronic
1077091479 11:780225-780247 CAACCCTGGACACCCCACAGTGG - Intronic
1078069766 11:8100763-8100785 GCACCATGACCACCCCAGAAAGG - Intronic
1079326721 11:19499358-19499380 TAACCATGCTGACCCCACACAGG + Intronic
1079342622 11:19625120-19625142 TAACTATAGCCATCCCACAGTGG + Intronic
1081700401 11:45148889-45148911 TAGGCATGACAAACCCACAGTGG + Intronic
1082831848 11:57624155-57624177 TGACCATGACCACACCATCGTGG - Intergenic
1085181676 11:74541785-74541807 TAGCCAAGTCCACCACACAGTGG - Intronic
1087111917 11:94479673-94479695 CAATCATGACGATCCCACAGGGG - Exonic
1089682462 11:120126529-120126551 CCACCATGCCCAGCCCACAGTGG + Intronic
1092783326 12:12007093-12007115 TCACCATGCCCAGCCCTCAGTGG + Intergenic
1094548821 12:31430364-31430386 CAACCTTGACCAGCCGACAGTGG - Intronic
1095907805 12:47395540-47395562 TCACCATCACCACCCGACAATGG - Intergenic
1097573062 12:61356732-61356754 TCACCAGGCCCACCCCACTGAGG - Intergenic
1097958104 12:65506802-65506824 AAACCATGTCCACTGCACAGAGG - Intergenic
1100262679 12:92947826-92947848 CCACCATGCCCAGCCCACAGGGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102619316 12:114181406-114181428 CAACTAGGAACACCCCACAGGGG + Intergenic
1103126159 12:118424274-118424296 TAACCATGCCCACCCGGCACGGG - Intergenic
1109649606 13:65309346-65309368 TAACAAGCAGCACCCCACAGTGG - Intergenic
1112693493 13:101920674-101920696 TCACCACCACCCCCCCACAGTGG + Intronic
1118006327 14:61567335-61567357 TAACTATAATCATCCCACAGTGG + Intronic
1122070253 14:99201413-99201435 TGATCATCACCATCCCACAGGGG + Intronic
1125081492 15:35678590-35678612 AAAACATGACAACCCCAGAGAGG - Intergenic
1126414876 15:48407096-48407118 ACACCATAACCAACCCACAGGGG + Intergenic
1129334006 15:74841859-74841881 GAAGCCTGAACACCCCACAGAGG + Intronic
1131817367 15:96235354-96235376 TGACAATGCCCACCTCACAGAGG - Intergenic
1135113624 16:19708820-19708842 CATCTATGACCACCCCACATGGG + Intronic
1135822492 16:25696428-25696450 TAACCATGACCACTTTACACTGG + Intronic
1139197663 16:64939553-64939575 TAACTATGGTCACCCTACAGTGG - Intergenic
1143886373 17:10067921-10067943 TAACAGTGACCACACCTCAGTGG - Intronic
1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG + Intronic
1150506956 17:65708859-65708881 GCACCACGACCACCCCACTGGGG - Intronic
1152583257 17:81178350-81178372 CCAGCATGACCACCCCACAGGGG + Intergenic
1153333814 18:3901372-3901394 TAACCGTGGTCACCCCACAGTGG - Intronic
1154410740 18:14140856-14140878 CAACCTGGGCCACCCCACAGAGG - Intergenic
1160174414 18:76580699-76580721 TGCCCATGGCCACCCCCCAGAGG - Intergenic
1164470297 19:28524619-28524641 TAAACATCCCCACCCCACACTGG + Intergenic
1168453478 19:56484971-56484993 TAAACATGCTCACCACACAGTGG - Intergenic
927496013 2:23552469-23552491 TCACCCTAAACACCCCACAGTGG - Intronic
929779871 2:44950716-44950738 TCACCATGACAAACACACAGAGG + Intergenic
930194788 2:48498390-48498412 AAACCAAAACTACCCCACAGAGG - Intronic
935891810 2:107687318-107687340 TAATCATCACCAACCAACAGTGG - Intergenic
937229496 2:120389299-120389321 TAGCCCTGAGAACCCCACAGGGG - Intergenic
939348929 2:141006336-141006358 TAACTATAATCATCCCACAGTGG + Intronic
942356553 2:175119418-175119440 TAACCATTATGTCCCCACAGAGG + Intronic
943829899 2:192447343-192447365 TAACTATAGTCACCCCACAGTGG + Intergenic
945999750 2:216471639-216471661 CCACCATGCCCAGCCCACAGTGG + Intronic
947900732 2:233719285-233719307 TAGCCAGCACCGCCCCACAGAGG - Exonic
1170894158 20:20399028-20399050 TATCCATTATCACCCCACCGTGG - Intronic
1172109443 20:32536642-32536664 TAACCATGGCAACCCACCAGAGG + Intronic
1176673422 21:9754907-9754929 TATCCAGGCCCACCACACAGTGG + Intergenic
1176862323 21:14017562-14017584 CAACCTGGGCCACCCCACAGAGG + Intergenic
1179581611 21:42347888-42347910 TGACTGTGACCACCCCACATGGG - Intronic
1181055297 22:20258086-20258108 CCACCATCCCCACCCCACAGAGG + Intronic
1183807026 22:40220253-40220275 TAGCCATGGACAGCCCACAGTGG + Intronic
1184300431 22:43555672-43555694 TAAGGGTGACCTCCCCACAGTGG + Intronic
951240110 3:20276986-20277008 CCACCATGCCCAGCCCACAGTGG - Intergenic
951468484 3:23029469-23029491 TAACTATCACCACCTGACAGAGG + Intergenic
952429782 3:33212035-33212057 TAACTATGGCCATCCTACAGTGG - Intronic
952491875 3:33881432-33881454 CAACCATCACCAGCACACAGTGG + Intergenic
955700217 3:61674814-61674836 TAACCATGACACTCACACAGAGG - Intronic
959395784 3:105836476-105836498 ATACCATGAGCACCCCGCAGAGG + Intronic
960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG + Intronic
963110420 3:141683625-141683647 TTACCATTACCTCCCCGCAGAGG + Intergenic
964382702 3:156113797-156113819 TAATCATGACGACCCCATGGGGG - Intronic
965583417 3:170293471-170293493 TAACCCTGACCAGAACACAGAGG + Exonic
970600536 4:17638034-17638056 TAAACATCACCTCCTCACAGAGG + Intronic
971357136 4:25905366-25905388 TAAACCTGATCACCCCCCAGAGG - Intronic
984796369 4:183663863-183663885 TAAACATGAGCCCCACACAGTGG + Exonic
987961354 5:24813551-24813573 CCACCATTACCACCCAACAGAGG - Intergenic
994151733 5:96455716-96455738 TAACCATTGCCTCCTCACAGAGG + Intergenic
996654963 5:125924767-125924789 TAATAATGAGCACCCCACATCGG + Intergenic
996765323 5:127030220-127030242 CAGCCCTGACCTCCCCACAGCGG + Intronic
999347977 5:150841038-150841060 TAACATTCACCACCCCCCAGAGG - Intergenic
999563329 5:152829190-152829212 TCACCAAAACCACCCCACATGGG - Intergenic
1003226146 6:4207703-4207725 GATCCATGACCTCCCCATAGAGG - Intergenic
1005051898 6:21692429-21692451 AAACCTTGACCCCCACACAGCGG + Intergenic
1007780776 6:44253197-44253219 CAACCCTGACCACCCCATTGTGG + Exonic
1008625057 6:53307244-53307266 TAACCACTACCACCCAAAAGTGG - Intronic
1018143125 6:160859656-160859678 TAACCCTGATCACCCTGCAGCGG - Intergenic
1019596139 7:1859271-1859293 GAACCCTGACCAGGCCACAGTGG + Intronic
1020115292 7:5472810-5472832 AAGCCGTGAGCACCCCACAGTGG + Intronic
1021781700 7:24113266-24113288 GAACCATGACCCCCACACTGTGG - Intergenic
1028501681 7:91526291-91526313 TTACTATGACCACCATACAGAGG - Intergenic
1029224022 7:99012015-99012037 TAACCAAGAACAGCCCACAGGGG - Intronic
1029232159 7:99079214-99079236 TGGCCATGCCCACCCCCCAGTGG + Intronic
1030931883 7:115534879-115534901 TAACCATGATCAGGCCAAAGGGG + Intergenic
1032383168 7:131504448-131504470 TTACCATGACAACCCAACACTGG - Exonic
1034729812 7:153377376-153377398 AAGCCATTACCACCCAACAGGGG - Intergenic
1035458475 7:159024439-159024461 CAGCCATGACCTCCTCACAGTGG - Intergenic
1038066839 8:23972198-23972220 CAACCATGGACTCCCCACAGGGG + Intergenic
1043038322 8:75226719-75226741 CAATCATGCCCAGCCCACAGTGG + Intergenic
1044149505 8:88757628-88757650 TAACTATCATCACCCCACAGTGG + Intergenic
1044866908 8:96580450-96580472 AAAACATGTCCACCCCTCAGTGG - Intronic
1048416320 8:134231363-134231385 TAACACTGAGCACCCCTCAGAGG + Intergenic
1051992128 9:23163788-23163810 CTACCATCACCAGCCCACAGGGG - Intergenic
1053293323 9:36896450-36896472 AAACCAAGCCCATCCCACAGAGG + Intronic
1059732819 9:117073713-117073735 TACCCAAGAGCACCCCCCAGTGG - Intronic
1059947797 9:119429591-119429613 TGACCATGACCATCACACACTGG - Intergenic
1185937661 X:4276827-4276849 TAACCATAGTCATCCCACAGTGG - Intergenic
1187442692 X:19334389-19334411 TTTACATGACAACCCCACAGGGG - Intergenic
1188174960 X:26977663-26977685 GAACCATCCCCACCCCACAATGG - Intergenic
1188583811 X:31748748-31748770 TAATAATGACCACCCCTCAATGG + Intronic
1195099166 X:101537869-101537891 TAACCCTGACCAGAACACAGAGG - Intergenic
1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG + Intergenic
1196882046 X:120207421-120207443 TAGCCAAGTCCACCACACAGTGG - Intergenic
1199410903 X:147521599-147521621 TATCTATGACAAACCCACAGTGG + Intergenic