ID: 1148721561

View in Genome Browser
Species Human (GRCh38)
Location 17:49757181-49757203
Sequence CTGGGGGGGTGGAGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 916
Summary {0: 1, 1: 0, 2: 7, 3: 84, 4: 824}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148721561_1148721577 29 Left 1148721561 17:49757181-49757203 CCATCTGTCCTCCACCCCCCCAG 0: 1
1: 0
2: 7
3: 84
4: 824
Right 1148721577 17:49757233-49757255 CAAACCTGTATGCCTGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 142
1148721561_1148721567 -10 Left 1148721561 17:49757181-49757203 CCATCTGTCCTCCACCCCCCCAG 0: 1
1: 0
2: 7
3: 84
4: 824
Right 1148721567 17:49757194-49757216 ACCCCCCCAGCAACTCTCGGGGG 0: 1
1: 0
2: 1
3: 10
4: 111
1148721561_1148721576 28 Left 1148721561 17:49757181-49757203 CCATCTGTCCTCCACCCCCCCAG 0: 1
1: 0
2: 7
3: 84
4: 824
Right 1148721576 17:49757232-49757254 ACAAACCTGTATGCCTGAGCAGG 0: 1
1: 0
2: 1
3: 5
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148721561 Original CRISPR CTGGGGGGGTGGAGGACAGA TGG (reversed) Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183821 1:1324048-1324070 CTGGGGGGCTGAGGGACTGAGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900269785 1:1781142-1781164 CTGGGGAGGCTGAGGAGAGAGGG + Intergenic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900460869 1:2801632-2801654 CGTGGGTGGTGGGGGACAGAGGG + Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900599453 1:3496876-3496898 CTGAGGGGGTGGAAGATGGAGGG - Intronic
900666716 1:3820503-3820525 CTGGGGTGGAGGAAGGCAGATGG + Intronic
900732684 1:4272533-4272555 ATGGAGCGGTGGAGGACACAAGG - Intergenic
901737091 1:11319526-11319548 CTGGGGGGTTGGGGGAGACAGGG + Intergenic
902228523 1:15012418-15012440 ATGGGGGGTTGGAGAACAGTTGG + Intronic
902471288 1:16648770-16648792 CTGGGGGGGTCCAGGATTGATGG - Intergenic
902487518 1:16758675-16758697 CTGGGGGGGTCCAGGATTGATGG + Intronic
902562212 1:17284641-17284663 TTGGGAGGGTGGAGGGCAGAGGG - Intergenic
902583007 1:17421013-17421035 CTGGGAGGGTGGGGGTCTGAGGG - Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903177969 1:21591767-21591789 GTGGGGGGGCGCAGGCCAGAGGG - Intergenic
903179603 1:21598503-21598525 CTGGGGAGGGGGTGGAAAGAGGG + Intronic
903219576 1:21861713-21861735 GGGGGAGGGTGGAGGACAAATGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903374978 1:22860199-22860221 GTGGGTGGGAGGAGGCCAGATGG + Intronic
903743703 1:25573090-25573112 CGGGGCGGGGGGAGGTCAGATGG + Intergenic
904031465 1:27536092-27536114 CTGGTGTGGGGGAGGACGGATGG - Intronic
904311547 1:29632685-29632707 CTGGGAGGCTGGGGGACTGAGGG - Intergenic
904311562 1:29632733-29632755 CTTGGGGGCTGGGGGACTGAGGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904379228 1:30100178-30100200 CTGGGAGGATGGATGACACAAGG - Intergenic
904823452 1:33259356-33259378 CTTGGGGGGTGGAGGCAAGTTGG + Intronic
904842073 1:33379322-33379344 GTGGGGGGGTGGGGGGCAGGGGG - Intronic
905394433 1:37657864-37657886 CTGGGAGGGAGGAGCACAGAAGG + Intergenic
905664653 1:39755699-39755721 CTGGGGAGGTGGAGGCCAGTGGG + Intronic
905860874 1:41350201-41350223 CTGGGGCGGTGGAAGTCACAAGG + Intergenic
905925271 1:41745227-41745249 CTGGGCAGGTGGAGCACAGGAGG + Intronic
905966909 1:42105820-42105842 CTGGGCGTGTGAAGGACTGATGG + Intergenic
906110312 1:43318085-43318107 GGGGGCGGGTGGAGGCCAGAGGG + Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
907096397 1:51785130-51785152 CTGGGGGGGAAGGGGACAGTGGG + Intronic
907275513 1:53314704-53314726 CTAGTGGGGTGGAGGTCAGGGGG - Intronic
907400977 1:54224635-54224657 GTGGGTGGGTGGGAGACAGAGGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907657820 1:56362318-56362340 TTAGGGAGGTGGAGGCCAGATGG - Intergenic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
907979716 1:59469744-59469766 TTGGGAGGGTGGAGGACAAAGGG - Intronic
909307815 1:74103776-74103798 GCGGGGGGGGGAAGGACAGAGGG - Intronic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
911032693 1:93507162-93507184 TTGGGGGGGTGGGGGAGGGAGGG - Intronic
912263331 1:108130833-108130855 CTCGGGGGGTGGGGGACACTTGG - Intergenic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
913069326 1:115285063-115285085 CTGGAGATGTGGAGGACAGGTGG - Intergenic
915113151 1:153577649-153577671 GTGGGTGGGTGGAGGACTGGGGG - Intergenic
915333479 1:155127753-155127775 CTGGGGAGGTGGAGGAGGGGCGG - Exonic
915337154 1:155151430-155151452 TTGGGGGGGTGGGGGAGAGAGGG - Intergenic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915444459 1:155966888-155966910 CTGGGAGGGTGGGGTAGAGAGGG + Intronic
915963152 1:160283765-160283787 CTGGGGAGGTGGGGGACTCAAGG - Intronic
916360624 1:163963151-163963173 CTGGGGTGGTGGTGGCCATAGGG + Intergenic
916435063 1:164770392-164770414 CTGAGGAGTTGGAGCACAGAAGG - Intronic
916627704 1:166576462-166576484 ATGGTGGGGTTGAGGAAAGATGG + Intergenic
917107240 1:171504723-171504745 CTGGCGGGGTGGAGGGTAGGGGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917935175 1:179859706-179859728 CTGGAGGGATGGATGACCGAAGG - Intronic
917967510 1:180187770-180187792 GCAGTGGGGTGGAGGACAGAGGG + Intronic
918024469 1:180729536-180729558 CTGGCGAGGTTGAGGACAAAAGG - Intronic
918103830 1:181399533-181399555 CTTGGGTGGTGGGGGAAAGAGGG + Intergenic
918413439 1:184284177-184284199 CTGGAAGGGAGGAGGACAGAAGG + Intergenic
918454189 1:184690061-184690083 CTGGGGTTGTAGTGGACAGATGG - Intergenic
918826572 1:189331410-189331432 CTCGGGGGGTGGAGCCAAGATGG - Intergenic
919047399 1:192470477-192470499 CTGCTGGGGTTGAGGACAGGTGG + Intergenic
919097382 1:193054421-193054443 CTGGGGTTGTGGAAGACATATGG - Intronic
920709399 1:208280573-208280595 ATGGGAGGGAGGGGGACAGAAGG + Intergenic
920978534 1:210809166-210809188 CTGGGGAGGTGGGGGAGGGAGGG + Intronic
921031093 1:211335825-211335847 CAGGAGAGGTGGAGGACAGGTGG + Intronic
921582817 1:216914813-216914835 CTGTCTGGGCGGAGGACAGAGGG + Intronic
921933157 1:220771749-220771771 CTCGGGGGGTGGGGGACAAGGGG + Intronic
922108143 1:222530325-222530347 CTGGGGTGGTGCTGGACACAGGG + Intronic
922205192 1:223440270-223440292 CAGGGAGGGTGGAGTAGAGATGG + Intergenic
922472781 1:225887125-225887147 CTGGGAGGGCTGAGGTCAGAGGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923013029 1:230104178-230104200 CTGGGGTGGTGGGGGGCCGAGGG + Intronic
923306659 1:232694606-232694628 GTGGGGGGGTTGAGCACAGTGGG + Intergenic
923542294 1:234897323-234897345 ATGGGGCGGAGGAGAACAGATGG + Intergenic
923591983 1:235327810-235327832 TTGGGGGGGAGAAGGAGAGAGGG - Exonic
924044192 1:240011148-240011170 CTGGAGGGGAGGAGGAGGGACGG - Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
1062842027 10:679425-679447 CTGGGTGTGGGGAGTACAGATGG - Intronic
1062890719 10:1057318-1057340 CTGGAGGGGTTGGGGGCAGAAGG + Intronic
1063201222 10:3786074-3786096 CTGGTGGCCCGGAGGACAGAGGG - Intergenic
1063578026 10:7279282-7279304 CTGGTGTGGAGGAGGAGAGATGG - Intronic
1063679159 10:8170640-8170662 CTGGGTGGGGGCAGGAGAGAGGG + Intergenic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064138204 10:12768449-12768471 CTGGGGCGGGGGAGGAGAGCTGG + Intronic
1064925532 10:20564989-20565011 CTGGGTGGGTGGATGAAAAAAGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065302362 10:24334410-24334432 ATGGAGGGGTGGAGGAGGGAGGG + Intronic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1066139440 10:32488615-32488637 CTGGGGGGTTGGAGCCAAGATGG - Intronic
1066725314 10:38385931-38385953 TTGTGGGGATGGAAGACAGAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067095766 10:43298661-43298683 CTGTGGAGGAGGAGGACATAGGG - Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1068866203 10:61897730-61897752 GTGGGGGGGTGGATGGCTGAGGG + Intergenic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069679909 10:70277147-70277169 CTGGGGAGGCAGAGGCCAGATGG - Intronic
1069878585 10:71578026-71578048 CTCCTTGGGTGGAGGACAGAGGG - Intronic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070161125 10:73867385-73867407 CGGGGGGCATGGAGAACAGACGG - Intronic
1070516643 10:77214255-77214277 ATGGGAGGTTGGAGGAGAGAAGG - Intronic
1070790870 10:79188611-79188633 CTAGGGGGGTGGGGGACAGGAGG - Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1072161756 10:92773736-92773758 GTAGGGGAGTGGAGGATAGAAGG - Intergenic
1072624042 10:97099451-97099473 TTGGGGGGGTGGGGGACAGCAGG + Intronic
1072766279 10:98097415-98097437 CTGGTGGGACGCAGGACAGAAGG - Intergenic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073295297 10:102435076-102435098 TCTGGGGGGTCGAGGACAGAAGG + Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073435735 10:103514614-103514636 CAGGGCTGGTGGAGAACAGAGGG + Intronic
1073553339 10:104424406-104424428 CTGGAGGTGTGCAGGACAAAAGG - Intronic
1073786796 10:106898670-106898692 GTGGGGGAGTGGAAGACACAGGG + Intronic
1073993255 10:109287920-109287942 CAGGGAGGGTGGAGGAAAGTGGG - Intergenic
1074100864 10:110354044-110354066 CTGGGGGGGTGGATGAGACAAGG + Intergenic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075221147 10:120585860-120585882 CGGGGGGATTGGAGGACAGCAGG - Intronic
1075407786 10:122206083-122206105 CTGGGGGGCGGGGGGAAAGAGGG + Intronic
1075806878 10:125195545-125195567 CTTGGGTGGGGGAGGACAGAGGG + Intergenic
1076022371 10:127084743-127084765 CTTGGTGGGTGGAGGACAGGTGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076114059 10:127883029-127883051 CTGGGAGGATGGAGCCCAGATGG - Intronic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1076610516 10:131723173-131723195 CTGGTGCGGAGCAGGACAGAAGG + Intergenic
1076722536 10:132398992-132399014 CTGGGGGAGAGGAGAACAGCCGG - Intronic
1076732507 10:132445761-132445783 CTGGGAGGGCAGAGGACAGGTGG + Exonic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1076870368 10:133189876-133189898 ATGGGGGGCTGCTGGACAGATGG - Intronic
1076886863 10:133267016-133267038 CTGGGGCCCTGCAGGACAGATGG - Intronic
1076988928 11:259145-259167 GGGGTGGGGTGGAGGGCAGAGGG - Intergenic
1077483667 11:2828462-2828484 CTGGGAAGCAGGAGGACAGATGG + Intronic
1077537188 11:3130018-3130040 CTGGTGGGGAGCAGGACAGAGGG - Intronic
1077724495 11:4660899-4660921 ATGATGGGGTGGAGCACAGAAGG + Intergenic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078583143 11:12555493-12555515 CTGGGGGGGTGGGGGAAATGGGG + Intergenic
1078616123 11:12867821-12867843 CTGGGTGGGTGGGGAGCAGAGGG + Intronic
1078846043 11:15119283-15119305 GTGGGGGGTTGAAAGACAGAGGG - Intronic
1078863568 11:15276069-15276091 GTGGGGGGGTGGATAAGAGAGGG - Intergenic
1078918399 11:15802867-15802889 GTTGGGGGGTGGGGGACAGGGGG - Intergenic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1079117901 11:17652227-17652249 CTGGGGGGCTAGAGGCCAAAGGG - Intergenic
1080206528 11:29735848-29735870 GTGGGTGGGTGGGGGACAGATGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1081831663 11:46120543-46120565 GGGGAGGGGTGGAGGGCAGAGGG + Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082737608 11:56873936-56873958 CTGGAGGGGTGGAAGTCAGTGGG - Intergenic
1082757912 11:57096390-57096412 GTGGGGTGGTGGAGGAGAGATGG + Intergenic
1083259954 11:61517521-61517543 ATGGAGGGGTGGAGGAAAGAAGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083509225 11:63191676-63191698 TTGGGGGGGTGGAGCCAAGATGG - Intronic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1083744093 11:64725804-64725826 CGGAGGGGGCTGAGGACAGAAGG + Intergenic
1083840485 11:65301593-65301615 CTGGGAGGGTGGCCGAGAGATGG + Intronic
1083922536 11:65788346-65788368 TGGGGGTGGGGGAGGACAGAAGG - Intronic
1084006560 11:66326411-66326433 GTGGAGGGGTGGAGGGCGGAGGG + Intergenic
1084596366 11:70119214-70119236 ATGGGTGGGTGGAGGAATGATGG + Intronic
1084675265 11:70630327-70630349 CTGTGAGGGTGGCAGACAGAAGG + Intronic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085283280 11:75344606-75344628 GTAGGGGGTTGGAGAACAGAGGG - Intronic
1085283451 11:75345386-75345408 GTAGGGGGTTGGAGAACAGAGGG - Intronic
1085340649 11:75729007-75729029 CTGGGAGGGAGGAGGCCAAAGGG + Intronic
1085438324 11:76531922-76531944 CCTTGGGGGTGGAGGACAGTAGG - Intronic
1085461798 11:76698513-76698535 GTGGTGAGGTGGAGGACAGTCGG - Intergenic
1085482824 11:76836947-76836969 CTTGGGGGGTGTGGGGCAGAGGG - Intergenic
1085789239 11:79482503-79482525 ACCTGGGGGTGGAGGACAGAAGG + Intergenic
1087757478 11:102069958-102069980 TTTGGGGGGTGGAGGAGACAGGG - Intronic
1088128797 11:106462001-106462023 TTGCTGGGGTGGAGGACAGGGGG + Intergenic
1088782099 11:113145760-113145782 CTCAGGGGGTGGAGGAAAGTGGG - Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089619830 11:119715783-119715805 CTGGGTGGATGGTGGAGAGATGG - Intronic
1089621736 11:119726599-119726621 CTGAGTGGGTGGAGCACAGCAGG + Intronic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089974142 11:122717814-122717836 CATGGGGGGTGGGGGACAGTAGG - Intronic
1090172696 11:124618649-124618671 GTGGGGGGGTGGGGGAGACAGGG + Intronic
1090715399 11:129426213-129426235 CTAGGAGAGAGGAGGACAGAGGG - Intronic
1090800635 11:130169459-130169481 CTGAAGGGGTGGGGGACAGGAGG + Intronic
1090877256 11:130801727-130801749 CTGGGTGGGTGGAGGAAGGTGGG + Intergenic
1090878488 11:130812788-130812810 CTGGAGGGCAGGAGGAGAGAAGG - Intergenic
1091161569 11:133426566-133426588 CTGGGGCAGAGGAGGAGAGAGGG - Intronic
1091322224 11:134659837-134659859 CTTAGAGGCTGGAGGACAGATGG + Intergenic
1091413751 12:262136-262158 CTGGGAGGGTGGAGAAGGGAAGG - Intronic
1091445537 12:542548-542570 CTGGGGGAGGGGAGGACATGGGG + Intronic
1093588564 12:20872152-20872174 CTGTGGTGGTGGTGGACACAGGG - Intronic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095963712 12:47852228-47852250 CTAGTGGGGAGTAGGACAGAGGG - Intronic
1096177954 12:49535380-49535402 GTTGGGGGCTGGAGGAAAGATGG + Intergenic
1096258159 12:50075169-50075191 GGGAGGGGGTGGAGGACTGAGGG - Intronic
1096518849 12:52172994-52173016 CTGGGGGCGGGGAGGAGAGCAGG - Intronic
1096606866 12:52772910-52772932 CTGGGTGGGAGGGGAACAGAGGG - Intronic
1097169585 12:57105340-57105362 CTGGGAGTGAGGAGGACACAAGG + Intronic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1097896009 12:64825194-64825216 CTGGAAGGGTAGAGGGCAGACGG + Intronic
1098345576 12:69499523-69499545 ATTGGAGGGTGGAGGGCAGAGGG - Intronic
1098440535 12:70512720-70512742 CTTGGGGGGTGGTGGAAGGAGGG + Intergenic
1098896733 12:76071274-76071296 CTGGGAGGGTGGAAGTCAGAGGG - Intronic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100607785 12:96165972-96165994 CTGGGGGGTGGGAGGACAGACGG - Intergenic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102656288 12:114484937-114484959 CGGGGCGGCTGCAGGACAGAGGG + Intergenic
1102891504 12:116561968-116561990 ATGAGGGGGTGGAAGAGAGATGG - Intergenic
1103047288 12:117747429-117747451 GTTGGGGGGTGGGGGACAGGGGG + Intronic
1103188537 12:118981424-118981446 TTGGTGGGGAGGAGGAGAGACGG + Intergenic
1103621627 12:122190455-122190477 ATGGGGAGTTGCAGGACAGACGG - Intronic
1103715868 12:122945037-122945059 CTGGGCATGAGGAGGACAGATGG - Intronic
1103725546 12:122995812-122995834 CTGGTGGGTGGGAGGACAGAAGG - Intronic
1104074152 12:125374620-125374642 GTCGGGGGGTGCAGGGCAGAGGG - Intronic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1104383787 12:128331084-128331106 CTGGGGGGCAGGGGGAAAGAGGG - Intronic
1104661001 12:130611406-130611428 CTGCGGGAGTGGAAGACAAAAGG - Intronic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1105280466 13:18960002-18960024 GTCTGCGGGTGGAGGACAGATGG - Intergenic
1105309065 13:19190236-19190258 CTGGGAGGGTGGGGAACAGGGGG - Intergenic
1105528540 13:21197912-21197934 CTGGGAGGGTGGGGAACAGGGGG + Intergenic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1105852439 13:24347820-24347842 TTGGGGGGGTGGAGGGGGGAGGG + Intergenic
1106297492 13:28429886-28429908 CTTGGGTGGTGGAGGTGAGAAGG - Intronic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1107297139 13:38921495-38921517 CCTGGGGGGTGGAGCAAAGAGGG + Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1109718371 13:66246199-66246221 CTGCAGGAGTGGAGCACAGATGG + Intergenic
1111721429 13:91950343-91950365 CTGGGAGGGAGGAGGAGGGAGGG - Intronic
1112256313 13:97835062-97835084 ATGGGGGGATGGAGTACAAAGGG - Intergenic
1112338894 13:98536867-98536889 CTGGGCGGCTGGAGGACAGGCGG - Intronic
1112338903 13:98536900-98536922 CTGGGCGACTGGAGGACAGGCGG - Intronic
1112589641 13:100751343-100751365 CTGGGGGCTTTGAGGAGAGAAGG + Intergenic
1113897533 13:113775676-113775698 CTGAGGGAGTGGAGCACAGGCGG + Intronic
1113909772 13:113836457-113836479 CGGAGGGGGAGGAGGACGGAGGG + Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114618198 14:24079636-24079658 CTGGGGAGGGGGTGGAGAGAGGG + Intergenic
1114674418 14:24430939-24430961 CTGGAGGGATGGGGGAGAGAAGG - Intronic
1115211742 14:30973332-30973354 GTGGGGGGGAGGGGGAGAGAAGG + Intronic
1115357732 14:32466571-32466593 GTTGGGGGGTGGGGGACAAAGGG + Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1116430083 14:44836127-44836149 CCGGGGTGGGGGAGGGCAGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117587726 14:57228702-57228724 TTGGGGGGGTGGGGGACTAAGGG + Intronic
1118360647 14:65053815-65053837 CTGGGATGGGGGAAGACAGAGGG - Intronic
1118497788 14:66325875-66325897 CTTGGGAGGTGGAAGACAGAAGG + Intergenic
1118729864 14:68658688-68658710 CTGGTGGGGTGTGGGGCAGAAGG - Intronic
1119156423 14:72415669-72415691 CCGGGGGGGTGGAGCCAAGATGG - Intronic
1119867796 14:77988603-77988625 GTGGGGAGGTGGAGGCCAGATGG + Intergenic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1120240972 14:81949024-81949046 TTGGGGGGGCAGAGGACAAAAGG + Intergenic
1120861005 14:89254880-89254902 GTGGGGGAGTGGACAACAGAAGG - Intronic
1121665875 14:95671744-95671766 CAGAGGAGGAGGAGGACAGAGGG + Intergenic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1121799349 14:96760716-96760738 CTGGGTGGGTGGATGAATGATGG + Intergenic
1121963181 14:98280468-98280490 AGGGTGGGGTGGAGGGCAGACGG - Intergenic
1122162034 14:99791938-99791960 CTTGGTGGATGGAGGACAGTGGG - Intronic
1122450875 14:101806254-101806276 GTCGGGGGGTGGGGGACAGGGGG - Intronic
1122663913 14:103316057-103316079 GTGGAGAGGTGGAGGACAGACGG - Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122699914 14:103581422-103581444 CTGTGGAGGTGCTGGACAGAGGG + Intronic
1125244453 15:37618974-37618996 CTTGGGGGGTGGGGGACTGGGGG - Intergenic
1125340620 15:38671970-38671992 CTGGGGGTGTGGAGAACAGCAGG + Intergenic
1125482332 15:40089196-40089218 CTGAGGGGGTGGAGGTCGGGGGG + Exonic
1125825408 15:42672253-42672275 TTGGGTGGGAAGAGGACAGAGGG + Intronic
1126154915 15:45556965-45556987 TTGGGGGGGCGGGGGAAAGAAGG - Intergenic
1126376324 15:48000535-48000557 CTGCTGGGGAGGAGGAGAGAAGG - Intergenic
1126542571 15:49839349-49839371 CGGGGGGGGTGGAGCCAAGATGG - Intergenic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127931517 15:63600393-63600415 CTGGGGCGGCTGTGGACAGAGGG - Intronic
1129249618 15:74301642-74301664 CTGGGGAGGTGGTGGATAGGGGG + Intronic
1129464442 15:75716044-75716066 GTGGGAGGGAGGAGGAAAGAAGG + Intergenic
1129720804 15:77876968-77876990 GTGGGAGGGAGGAGGAAAGAAGG - Intergenic
1129759374 15:78120662-78120684 CTGGGTGGGGGCAGGGCAGAGGG + Intronic
1129803760 15:78437608-78437630 CTGGGTAGGTGGAGAACACAGGG + Intronic
1129826599 15:78638627-78638649 CCGGGGGGGTGGTGCACTGAAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130321972 15:82849124-82849146 CTGGGGGGGCGGGGGGCAGGGGG + Exonic
1130605128 15:85308621-85308643 CTGGGGAGGCCGAGGACAGCAGG + Intergenic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132645793 16:998726-998748 CTGGGTAGGTGCAGGGCAGAAGG + Intergenic
1132746830 16:1439678-1439700 CTGGGGGGCAGGAGGCCAGCAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133569285 16:7025626-7025648 CTGGGGGGGTTTTGGATAGAGGG + Intronic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1134224851 16:12381799-12381821 GTGGGTGGATGGATGACAGATGG - Intronic
1134342544 16:13358377-13358399 GTTGGGGGGTGGGGGACAAAGGG - Intergenic
1135258989 16:20964941-20964963 TTGGGGGAGAGAAGGACAGATGG - Exonic
1136316186 16:29455758-29455780 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1136318398 16:29466999-29467021 CTGGGGCGGAGGAGGCCCGACGG - Exonic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1136430763 16:30195100-30195122 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1136432973 16:30206348-30206370 CTGGGGCGGAGGAGGCCCGACGG - Exonic
1137024944 16:35464409-35464431 CAGGTGGGGTGGTGGAGAGAAGG + Intergenic
1137708575 16:50551120-50551142 ATGGGAGGGAGGAGGAAAGAGGG + Intronic
1138019108 16:53461117-53461139 CTGGGGATGTGTAGGACAGGTGG + Intronic
1138089916 16:54165545-54165567 CCGCGGGGCTGAAGGACAGAAGG + Intergenic
1138205329 16:55120324-55120346 CTGGGGCAGGGTAGGACAGATGG - Intergenic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138592527 16:58009906-58009928 CTGGAGGGGAGGAGTAAAGAGGG - Intronic
1139333250 16:66210657-66210679 GTTGGGGGGTGGGGGACAAAGGG - Intergenic
1139428148 16:66895796-66895818 CTGGGACAGGGGAGGACAGATGG - Intergenic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1139709369 16:68763978-68764000 TTGGGGGGATGGCGGACACATGG + Intronic
1140245453 16:73244349-73244371 CTTGGAGGATGGAGGAGAGAAGG - Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141155380 16:81593370-81593392 CTGGGGGGTTGGAGGGCGGGGGG + Intronic
1141534326 16:84668673-84668695 CTGGGGGGGCGGGGAAGAGAAGG - Intergenic
1141620008 16:85232343-85232365 CTGGGAAGGTGGAGGTCCGAGGG - Intergenic
1141625558 16:85259350-85259372 CAGGAGGGGTGGAGCACGGAGGG - Intergenic
1141647503 16:85375501-85375523 CTGGTGGGGTGCAGGGCAGCCGG + Intergenic
1142478546 17:204365-204387 GTGGGTGGGTGGAGGACAGATGG - Intergenic
1142596810 17:1033760-1033782 CTGAGGGGGAGGTGGAGAGACGG + Intronic
1142878712 17:2868129-2868151 CTGCTGGGGTGGAGGGCAGCTGG - Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143109215 17:4544133-4544155 CTGGGGTGGAGGGGGACAGTGGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1144008456 17:11122743-11122765 CTGGGGTGATAGAGGACACAGGG + Intergenic
1144036009 17:11366642-11366664 CTGGGAGGTGGCAGGACAGATGG + Intronic
1144465674 17:15495040-15495062 TGGGGGGGGTGGAGGAGAGGAGG + Intronic
1144832272 17:18138392-18138414 CTGGGGTGATTGAGGCCAGATGG + Intronic
1144849543 17:18237073-18237095 CTGGCTGGGGTGAGGACAGATGG + Intronic
1146178148 17:30679698-30679720 CAGAGGAGGGGGAGGACAGAGGG + Intergenic
1146641404 17:34544322-34544344 ATGGGAGGGTGGAGGTCAGAGGG + Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147907409 17:43832436-43832458 CTTGGGGGGTCGGGGACAGGGGG - Intronic
1147909924 17:43849368-43849390 CTGGGGAGGTGGAGGCCAGGAGG - Intronic
1147947319 17:44087352-44087374 CAGGGGTGGAGAAGGACAGAGGG + Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148124067 17:45228032-45228054 ATGGGGGGCTGGGGGACACACGG - Intronic
1148334500 17:46832403-46832425 GGGGGGTGGTGGAGGAGAGAAGG + Intronic
1148552453 17:48558597-48558619 CTGGGAGGCTGGAGGACGGAGGG + Intronic
1148618434 17:49016803-49016825 CGGGGGGGCAGGAGGACAGGGGG - Intronic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150281419 17:63931509-63931531 CTGGGGGCAGGGAGGACCGAGGG - Intronic
1150613102 17:66749282-66749304 CCGGAGGGGTGGAGGGCAGGGGG - Intronic
1151666034 17:75545578-75545600 CTGGGGAGGGGCAGGGCAGACGG - Intronic
1151740945 17:75981615-75981637 CTGAGGGAGAGGAGGACAGAAGG - Intronic
1151882990 17:76905995-76906017 CTGGGTGGGCGGAACACAGAGGG - Intronic
1152226947 17:79097163-79097185 CTGGGGGGGGGGAGGATCGTGGG - Intronic
1152278808 17:79373223-79373245 GTAGGGGTGGGGAGGACAGAGGG - Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152531665 17:80922687-80922709 ATGGGGGTGTGAAGGTCAGACGG - Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152598916 17:81251665-81251687 TTGGGGGGTTGGGGGACAGAAGG + Intronic
1152771522 17:82172571-82172593 GAGGGAGGGAGGAGGACAGACGG - Intronic
1152779013 17:82218260-82218282 CTGGGGGGGTGGACGGCCAAGGG + Intergenic
1152779042 17:82218339-82218361 CTGGGGGGGTGGACGGCCAAGGG + Intergenic
1152779058 17:82218379-82218401 CTGGGGGGGTGGACGGCCAAGGG + Intergenic
1152795487 17:82304276-82304298 CTGGAGTGGTGAAGGACAGTGGG - Intergenic
1152942930 17:83181956-83181978 CTGGGGGGGTGCAGGGGGGATGG + Intergenic
1153345850 18:4025022-4025044 ATGGGAGGCAGGAGGACAGAGGG - Intronic
1155232197 18:23784537-23784559 ATGGGAAGGTGGATGACAGAAGG + Intronic
1155277149 18:24199288-24199310 CTGGGGGTGTGGCGAACAGTGGG + Intronic
1156469305 18:37367454-37367476 GTGGGGATGGGGAGGACAGAGGG + Intronic
1156867647 18:41906722-41906744 CAGGAGGGGTGTAGGAGAGAAGG - Intergenic
1157248067 18:46071376-46071398 CTGGGGAGTGAGAGGACAGAGGG + Intronic
1157342727 18:46793861-46793883 CTGGGGAGGGGCAGGACTGATGG + Intergenic
1157453868 18:47809153-47809175 CTGGGGAGGTGGAGGTCAAAGGG + Exonic
1158311095 18:56159384-56159406 TTTGGGAGGTCGAGGACAGAGGG + Intergenic
1159022556 18:63155498-63155520 CTGCTGGGGTGGAGGCCACAGGG + Intronic
1159312378 18:66725942-66725964 CTGGGTGGGTAGAGGAGAGTTGG + Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159581944 18:70242854-70242876 GTCGGGGGGTGGAGGGCAAAGGG + Intergenic
1160545305 18:79649020-79649042 GTGGTGGGATGGAGGACTGAGGG - Intergenic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160779648 19:872144-872166 CTGGGGCGGCGGGGGGCAGATGG + Intronic
1160980124 19:1812789-1812811 CAGGGTGGGTCCAGGACAGAAGG + Intergenic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161129843 19:2581329-2581351 GTGGGGGGGTGGGGGGCGGAGGG + Intronic
1161186753 19:2926556-2926578 CTGCCGGTGTGGGGGACAGAGGG - Intergenic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161498155 19:4598479-4598501 CTGGCGGTGGGGAGGTCAGAGGG - Intergenic
1161640750 19:5421183-5421205 CTGGAGGGGTGGGGGACGGGAGG + Intergenic
1161649970 19:5478312-5478334 CTGGGGGGGTGGGCGGCAGGGGG - Intergenic
1161977218 19:7613277-7613299 GTGGGCGGGTGGGGGATAGATGG + Intronic
1162318988 19:9959813-9959835 CTGGGGAGGTGGGGGGCAGGGGG + Exonic
1162399431 19:10435914-10435936 CTGGGCTGAGGGAGGACAGAGGG - Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1162926357 19:13932223-13932245 CATGGGGGGTGGGGGGCAGAAGG - Intronic
1163251205 19:16127414-16127436 CTGAGAGGGAGGGGGACAGACGG - Intronic
1163637825 19:18445555-18445577 GTGGGGGGGTGCAGCAAAGAGGG + Intronic
1163668461 19:18613849-18613871 CTGGGGGAGGGGAGGACAGGGGG - Intronic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1164685974 19:30167185-30167207 GTGGGTGGGTGGAGGCCAGAAGG + Intergenic
1165230200 19:34381950-34381972 CTGGGGGGGTGGCGTAGAGGAGG + Intronic
1165282615 19:34810038-34810060 CGGGGGTGGTGGAGGGGAGAAGG - Intergenic
1165421786 19:35725646-35725668 CAGGGTGGGTGGAGGCCTGAAGG + Intronic
1165926290 19:39328163-39328185 CTTGGGGGGTGGGGGACGGATGG - Intergenic
1165979354 19:39706694-39706716 TGGAGGGGGTGGAGGAGAGAAGG + Intronic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1166305266 19:41933984-41934006 GTGGAGGGGTGGGGGGCAGAGGG + Intergenic
1166321609 19:42022375-42022397 CAGGGGTGGAGGGGGACAGAGGG + Intronic
1166529429 19:43533800-43533822 ATGGGGCCGTGGAGGATAGAGGG - Exonic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1167099341 19:47394407-47394429 CTGGGTGTGAGGACGACAGAAGG - Intergenic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167236417 19:48318665-48318687 CTGGGGAGGAGGGGGTCAGAGGG - Intronic
1167400232 19:49261669-49261691 CTAGGGGGGTGCTGGGCAGAGGG + Intergenic
1167524952 19:49977767-49977789 CTGGAGAGGTGGGGGAAAGAGGG + Intronic
1167525227 19:49979322-49979344 ATGGAGGGGTGGGGGACTGAGGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1168173995 19:54609545-54609567 CCGGGAGGGTGGAGGACAGATGG - Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
1202703687 1_KI270713v1_random:5565-5587 CTGGGGGGGTCCAGGATTGATGG - Intergenic
925302225 2:2825637-2825659 CGCGGGGGTTGCAGGACAGAAGG - Intergenic
925904786 2:8534071-8534093 CTGGAGGGGAGGTGGACAGTGGG + Intergenic
926516318 2:13851020-13851042 CTGGGGTGGTGGTGGCCACAGGG + Intergenic
926683093 2:15678669-15678691 CTGGGGGGCTGGAGGACTTGGGG + Intergenic
927142134 2:20137720-20137742 CTGGAGGGTTGGGGGTCAGAAGG - Intergenic
927143514 2:20145511-20145533 GTGGGGGGTGGGAGGACGGATGG + Intergenic
927560567 2:24069524-24069546 CTGGGTGGTTGGAACACAGATGG - Intronic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
928088568 2:28360469-28360491 CTGGGGCGGGTGAGGACATATGG - Intergenic
928460749 2:31470204-31470226 TTGTGGAGGTGGAAGACAGACGG - Intergenic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
928764971 2:34635308-34635330 CTTGGGGGGTGGAGCCAAGATGG + Intergenic
928837929 2:35569187-35569209 CTCGGGGGGTGGAGCCAAGATGG - Intergenic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929438335 2:41946100-41946122 CTGGAGGGGAGGAGGAGACAGGG + Intronic
929620480 2:43349292-43349314 GTGGAGGGGTGAGGGACAGAGGG - Intronic
929656116 2:43733404-43733426 CTGGAGGAGTGGAGGAGAAAGGG - Intronic
929728305 2:44457131-44457153 CTGGGTTGATGAAGGACAGATGG - Intronic
929889229 2:45905671-45905693 CTGGGAGGGTGGATGCCAGGTGG + Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
930837860 2:55814029-55814051 TTTGGGGGGTGGAGCAAAGATGG + Intergenic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
931847923 2:66223524-66223546 CTGGGAGGGAGGAGGAAAAAAGG + Intergenic
932206561 2:69888623-69888645 CTGGGGTGGTGAAGGAGAGGTGG + Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
933034603 2:77378660-77378682 TTGGGCTGGTGGAGGACATAAGG - Intronic
933806026 2:85998494-85998516 CTGGGGGTGGGGACGAGAGAGGG + Intergenic
933992956 2:87646795-87646817 CTGGCAGGGTGCAGGCCAGAGGG + Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
935384393 2:102485779-102485801 CTTGGGGGCTTGAGGAAAGAGGG - Intronic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
935989484 2:108706123-108706145 CTGGGGTTGTGGTGGACACAGGG + Intergenic
936069736 2:109358051-109358073 CAGGGGTGGTGGAGGAGGGAGGG - Intronic
936300901 2:111304084-111304106 CTGGCAGGGTGCAGGCCAGAGGG - Intergenic
936516604 2:113185219-113185241 CTGGGTGGGAGGAGGATGGAGGG + Intronic
937196625 2:120163252-120163274 TTGGGGGGGGGGGGGGCAGAGGG - Intronic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
937257241 2:120564275-120564297 CTGGGGGCGAGGCGGGCAGAGGG + Intergenic
937307558 2:120881603-120881625 GTGGCGGGGGGGAGGACAGGTGG + Intronic
937477615 2:122229189-122229211 CTGGGAGGGTGGAGGAAGGGAGG + Intergenic
937985902 2:127637989-127638011 CGGGTGGGGAGAAGGACAGAAGG - Intergenic
937992536 2:127672612-127672634 CTGAGCGGGTGGAGGAGAGGAGG - Intronic
938100278 2:128493468-128493490 CTGGGGGCGTGGCTGACAGAAGG + Intergenic
938157595 2:128954949-128954971 CAGCGGGAGCGGAGGACAGAGGG - Intergenic
938264947 2:129921992-129922014 CAGGGGGGGTGGGGGGCAGCAGG + Intergenic
940468946 2:154068219-154068241 CTGGGGAGGATGAGGACAAAAGG + Intronic
940528891 2:154854095-154854117 ATGGGGGGTGGGAGGACAAAAGG - Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
940987581 2:160063763-160063785 GTTGGGGGGTGGGGGACAGCCGG + Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941725799 2:168858781-168858803 CTGGAGGTGTGGGGGAGAGAGGG + Intronic
942074651 2:172345530-172345552 CTCGGGGGGCTGAGGGCAGAAGG + Intergenic
942483864 2:176419160-176419182 CTGGGTGGGTAGAGGAGAGTAGG - Intergenic
944223518 2:197325996-197326018 CTGGGGTGGTGAGGGAGAGATGG - Intergenic
946010521 2:216560204-216560226 GAGGGGAGGGGGAGGACAGAGGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946327144 2:218990604-218990626 ATGAGGGGGTGGAGGAAATAAGG - Intronic
946370583 2:219279310-219279332 CTGGGGGGGTGGGGGCCTGCAGG - Exonic
946372854 2:219290973-219290995 CTGGGGGAGGGGAGGACACTGGG + Intronic
946543031 2:220706840-220706862 CAGGGCTGGTAGAGGACAGAGGG - Intergenic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947897188 2:233686691-233686713 GTGGGAGGGTGCAGGCCAGAGGG - Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948583380 2:239003281-239003303 CTGGGAGGGTGGAGCGCACACGG - Intergenic
948807934 2:240460977-240460999 CTGGTGGGGGGGCGGACACAGGG - Intronic
1168856293 20:1011605-1011627 CTGGTGGGCTGGGGGACAGCAGG + Intergenic
1169067308 20:2701356-2701378 CTGGGAGGGGGGAAGACAGCAGG - Intronic
1170922979 20:20696622-20696644 GTGGAGGGGTGGAGGATAGAAGG - Intronic
1172097266 20:32466560-32466582 CTGGGGGAGGGGAGGCCAGGAGG + Intronic
1172164771 20:32892436-32892458 CTGGTGGGGAGGAAGACACAGGG - Intronic
1172634520 20:36401061-36401083 CTGGGCGGGTGGGGGACTGGAGG - Intronic
1173147097 20:40534440-40534462 TTGGGGGGGTGCATGACAGAAGG - Intergenic
1173336810 20:42118764-42118786 CTGAGCAGGAGGAGGACAGAAGG - Intronic
1173427808 20:42958181-42958203 GAGGTGGGGTGGGGGACAGAAGG + Intronic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1174036677 20:47672813-47672835 CTGAGGGAGAGGAGGACCGATGG - Intronic
1174122444 20:48276380-48276402 ATCGTGGGGTGGAGGACAGAAGG + Intergenic
1174292495 20:49519129-49519151 GTGGGGTGGTGGGGGGCAGACGG - Intronic
1174391365 20:50220213-50220235 CTTGGGTGGTGGAGGTGAGAAGG + Intergenic
1174509106 20:51037676-51037698 CTGGGGCGAGGGAGGACAGATGG + Intergenic
1174563636 20:51448735-51448757 TTGGGGTGTTTGAGGACAGAGGG + Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175159018 20:56994325-56994347 CTGGGTGGGTGGAAGACAGCTGG - Intergenic
1175431686 20:58909498-58909520 CTGGTGGGGAGGAGGACAGCTGG - Intronic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175934689 20:62509444-62509466 CTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934716 20:62509512-62509534 GTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934799 20:62509722-62509744 GTGGAGGGGTGGAGGATAGAAGG - Intergenic
1175934831 20:62509812-62509834 GTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934893 20:62509993-62510015 GTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934903 20:62510016-62510038 GTGGAGGGGTGGATGACGGAGGG - Intergenic
1175934912 20:62510039-62510061 GTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934922 20:62510062-62510084 GTGGAGGGGTGGATGACGGAGGG - Intergenic
1175934963 20:62510185-62510207 GTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934991 20:62510261-62510283 GTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175935026 20:62510360-62510382 ATGGAGGGGTGGAGGATGGAGGG - Intergenic
1175935054 20:62510429-62510451 GTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175935273 20:62511115-62511137 CAGGAGGGGTGGAGGTCAGGAGG - Intergenic
1176103563 20:63375527-63375549 CTGGTGGGGTGCAGGGCTGATGG - Intronic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176311336 21:5152104-5152126 GTGGGGGGGTGGGGAACAGCCGG + Intronic
1176549358 21:8214663-8214685 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1176557251 21:8258886-8258908 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1176576193 21:8441921-8441943 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1176899872 21:14427163-14427185 GTGGGGGGTTGGAGGAGAGGTGG + Intergenic
1177771360 21:25519597-25519619 CTTGGGTGGTGGTGGACACAAGG + Intergenic
1178301380 21:31456252-31456274 CTGGAAGGGTGCAGGAGAGATGG + Intronic
1178488436 21:33033170-33033192 ATGGGGGAGTCGGGGACAGATGG - Intergenic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1179340152 21:40500121-40500143 CTGGGAGGGAGGAGGAGAAAAGG + Intronic
1179372960 21:40824123-40824145 GTGGGAGGCTGGGGGACAGAGGG - Intronic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179545949 21:42112273-42112295 CTGGGGAGGTGCAGAACAGCTGG - Intronic
1179845714 21:44109931-44109953 GTGGGGGGGTGGGGAACAGCCGG - Intronic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1179939583 21:44628933-44628955 CTGGGTGGGTGGAGGGCCGGTGG + Intronic
1180834388 22:18922644-18922666 GTGGGGAGGAGGAGGTCAGAGGG - Intronic
1181462398 22:23093523-23093545 CTATGGAGGAGGAGGACAGAGGG + Intronic
1181944938 22:26509198-26509220 CTTGGGGGCTGGAGCAGAGAGGG - Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1183029112 22:35088916-35088938 GTGGAGGAGTGGAGGAGAGAAGG - Intergenic
1183467870 22:37988927-37988949 CTGGGAAGGTGGAGGGCCGACGG + Intronic
1183617458 22:38954329-38954351 GTGGGGGTATGGGGGACAGAGGG + Intronic
1183738806 22:39658854-39658876 CAGGGGGAGAGGAAGACAGAGGG - Intronic
1184109043 22:42384490-42384512 CTGGGGGCATGGAGCAGAGAGGG - Exonic
1184355755 22:43978528-43978550 AGGGGTGGCTGGAGGACAGAGGG + Intronic
1184520782 22:44992748-44992770 GTGGCGGGGTGGGGGACAGGAGG + Intronic
1184887558 22:47355583-47355605 CTGGGGGGTGGGGGGACAGGTGG + Intergenic
1185053595 22:48566468-48566490 TTGGATGGGTGGATGACAGATGG + Intronic
1185146335 22:49138820-49138842 GTGGGTGGGTAGAGGACAAATGG - Intergenic
1185146342 22:49138843-49138865 ATAGGTGGGTGGATGACAGATGG - Intergenic
1185172876 22:49303887-49303909 CTGGCGGGCAGGAGGACACATGG - Intergenic
1185418674 22:50723151-50723173 CTGGGCAGGGGCAGGACAGACGG - Intergenic
1203254243 22_KI270733v1_random:130979-131001 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1203262299 22_KI270733v1_random:176058-176080 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1203284477 22_KI270734v1_random:147943-147965 GTGGGGAGGAGGAGGTCAGAGGG - Intergenic
949829206 3:8196584-8196606 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
950094288 3:10319805-10319827 GGGGGGGGGGGGAGGAAAGAGGG + Intronic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950119277 3:10470976-10470998 CTGGAGGGGTGGAGAACGGGGGG + Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG + Intergenic
950765858 3:15272490-15272512 CTGATGAGGTGGGGGACAGAAGG + Intronic
950974670 3:17227933-17227955 CTTGGGGAGTGGAGGATAGTGGG + Intronic
951231512 3:20185415-20185437 CAGGGGGTGTGGTAGACAGAAGG + Intronic
951245847 3:20340860-20340882 TTGGGAGGATGGAAGACAGAAGG - Intergenic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
951512702 3:23521882-23521904 CTGGGGGGGTGGGGGGTACACGG - Intronic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
952726311 3:36589424-36589446 TGAGGGGGGTGGTGGACAGATGG + Intergenic
953813164 3:46131885-46131907 CAGGGAGGGTGCAGGACACAAGG + Intergenic
954436371 3:50498495-50498517 GTGGAGGGGTGGAGGAGAGGAGG - Intronic
956647145 3:71467408-71467430 GTGGGTGGGTGGTGGACAAATGG + Intronic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
956861299 3:73326656-73326678 CTGGGGAGGGGGATGGCAGAGGG - Intergenic
957436713 3:80187124-80187146 CTTGGGGGGTGGGGGACAAGGGG - Intergenic
957612515 3:82486634-82486656 TTGGGGGGGTGGGGGACGGTGGG - Intergenic
958088388 3:88843164-88843186 CTGGAAGAGTGGAGGACAGGAGG + Intergenic
959935546 3:112024517-112024539 TTTGGGGGGTGGCGGACATAAGG + Intergenic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
960928755 3:122822954-122822976 GTGGGGAGGTGGAGGGCGGATGG - Intronic
961391257 3:126553461-126553483 CAGGGGTGGTGGGGGGCAGAAGG + Intronic
961661881 3:128473345-128473367 GTGGGGCCGAGGAGGACAGATGG + Intergenic
961872634 3:129999902-129999924 TTGGGGGGGTGGAGGGTGGAGGG - Intergenic
962333011 3:134496910-134496932 CTGGGGGGGATGTGGACAAAAGG - Intronic
962413400 3:135161309-135161331 GTGGGGGGGATGAGGACACAGGG + Intronic
962980615 3:140485957-140485979 CTGGGGGGTTGTCGGACAGTGGG - Intronic
963015689 3:140821864-140821886 CTGGGAGGGTGGAAGAGAAAGGG + Intergenic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963430548 3:145196884-145196906 GTTGGGGGATGGGGGACAGAGGG - Intergenic
963933841 3:151032578-151032600 ATCGGAGGGTGGAGGGCAGAAGG + Intergenic
965475028 3:169146588-169146610 CTGCGGGCGAGGAGGAAAGAAGG + Intronic
966668580 3:182500672-182500694 CTGGGGAGGGGGTGGACGGAGGG + Intergenic
966891683 3:184411823-184411845 CTGTGGGGGTGAAGGACGGGGGG - Intronic
967652781 3:192007454-192007476 GTGGTGGGTTGGGGGACAGAGGG - Intergenic
967762654 3:193242385-193242407 CCTGGGGAGTGGAGGAGAGAGGG + Intronic
967957305 3:194887078-194887100 CTGGAGGGGTGGAGGCCTCATGG - Intergenic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968539152 4:1154251-1154273 CTGGGTGGGTGGGGGAGAGCTGG + Intergenic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
968713336 4:2136793-2136815 CTGGGGAGGTGGTGGAAATAAGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968818232 4:2832659-2832681 CTGGGGTGGCGGAGGCCACATGG + Intronic
968924686 4:3541028-3541050 GAGGGGGGAGGGAGGACAGAGGG - Intergenic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
970149669 4:13075655-13075677 CTGGGGGGGTGGGGTGCTGAGGG + Intergenic
970210861 4:13708731-13708753 GTCGGGGGGTGGAGGACTGGGGG - Intergenic
970368957 4:15389009-15389031 CTGGTGGGGTGCAGGAGAGGAGG + Intronic
970380142 4:15499118-15499140 CTGAATGGGTGGAGCACAGAAGG + Intronic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
972186358 4:36532988-36533010 ATGGAGGGGTGGAGAACTGAGGG + Intergenic
975162776 4:71143085-71143107 GTGGGGGGATGGGGGAGAGATGG - Intergenic
976132140 4:81896065-81896087 GTGGGGGGCAGCAGGACAGAGGG - Intronic
977372718 4:96160487-96160509 CTGAGAGGGAGGAGAACAGAAGG - Intergenic
977574134 4:98658884-98658906 GTGGGAGGGTGGAGGACCGCAGG + Intergenic
977758314 4:100700235-100700257 CTGGGCTGGAGGAGGACAGATGG - Intronic
977902555 4:102438819-102438841 GTGGTGGGGTGGGGAACAGAAGG - Intergenic
978412593 4:108441571-108441593 TTGGGGGGGTGGAGCCAAGATGG - Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979589889 4:122465977-122465999 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
980884999 4:138752640-138752662 CTGGGGTGGAGGAGGAAGGAAGG - Intergenic
981011977 4:139934534-139934556 CTGAGGGGGTGATGGAGAGAAGG - Intronic
981140722 4:141265640-141265662 GTGGGGGGATGGAGTACGGATGG + Intergenic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
981537676 4:145816624-145816646 CTAGGCTGGTGGGGGACAGATGG + Intronic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982188779 4:152831925-152831947 CTCGGGGGGTGGGGGGCAAAGGG - Intronic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
984767141 4:183408323-183408345 CTGGGGGAGTGGGGGACGGTGGG - Intergenic
985524403 5:394769-394791 CTGGTTGCGTGGAGGGCAGAGGG + Intronic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
985651438 5:1109561-1109583 CTGCAGGGGTCGGGGACAGAAGG + Intronic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
986755456 5:10831859-10831881 GTGGGGGGATAGAGGAGAGAGGG + Intergenic
986939367 5:12931618-12931640 CTAGTGGGTTGGAAGACAGATGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987237941 5:15962094-15962116 CTGGAGGAGAGGTGGACAGATGG - Intergenic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988467347 5:31503154-31503176 CTGGGGTGGCTAAGGACAGAGGG - Intronic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
989533826 5:42540683-42540705 CGGGGGCGGTGGTGGATAGAGGG - Intronic
989591905 5:43120666-43120688 CTGGGCGGGTGGAGCACATGAGG - Intronic
989997460 5:50852922-50852944 TTGGGGTGGTGGAGGACACCAGG - Intergenic
990862452 5:60341855-60341877 GTGGTGGGGTGGAGGGCTGATGG - Intronic
990899999 5:60739544-60739566 CTGTGGTGGTGGTGGACACAGGG + Intergenic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991743655 5:69709535-69709557 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991774018 5:70066836-70066858 GTGGGGAGGTGAAGGATAGAGGG - Intronic
991795228 5:70289267-70289289 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991833370 5:70720820-70720842 CTACGGGGGTGGGGGAAAGAGGG - Intergenic
991853312 5:70942260-70942282 GTGGGGAGGTGAAGGATAGAGGG - Intronic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994546994 5:101180127-101180149 ATGGGGGGGAGGAGCCCAGATGG + Intergenic
994749000 5:103715359-103715381 GTGGGGGGGTGGGGGATTGAGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997756625 5:136405852-136405874 CTGGGCTGGTGGAAGACAGTTGG + Intergenic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
999758476 5:154682719-154682741 CTGGGCTGGGGGAGGACAGTGGG - Intergenic
1000194434 5:158944213-158944235 GTAGGGGGGTGGAGGACAAGGGG - Intronic
1000692720 5:164343304-164343326 GTGGGCTGGTGGAGGAGAGATGG - Intergenic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1001253265 5:170165005-170165027 GTGGTGGGGTGGAGGACACATGG - Intergenic
1001983193 5:176050840-176050862 CTGGGGGGGAGGAGGAAGTAAGG - Intronic
1002234272 5:177793212-177793234 CTGGGGGGGAGGAGGAAGTAAGG + Intronic
1002465544 5:179406477-179406499 CTGGGAGGGCGGGGGACAGGTGG - Intergenic
1004009130 6:11664739-11664761 TAGAGGTGGTGGAGGACAGAAGG + Intergenic
1004171990 6:13302414-13302436 ATGGCGGTGTGGAGAACAGAGGG - Intronic
1004450419 6:15739995-15740017 CTGGCGGTGGGGGGGACAGAAGG - Intergenic
1004579793 6:16939138-16939160 ATGGGGGCGAGGAGAACAGAGGG - Intergenic
1005327762 6:24719797-24719819 CTGCGGGGGTGGAAGGCAGGTGG - Exonic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1005928112 6:30461475-30461497 CTGGGTGGGTGGACAGCAGAGGG + Intergenic
1005959323 6:30684710-30684732 CTGGGGGTGGGGGAGACAGAGGG + Exonic
1006308572 6:33240682-33240704 CTGGGGGAGTTGAGGAGAAAAGG + Intergenic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006328509 6:33372425-33372447 CTGGGAGGGTGGTGCCCAGATGG + Intergenic
1006516154 6:34546813-34546835 CTGGGGATGTGGGGGACAGAGGG + Intronic
1006648519 6:35532319-35532341 CTGGGAGGGAGGGGGACTGAAGG - Intergenic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007595817 6:43050681-43050703 ATGGAGTGGTGGAGGCCAGAAGG - Intronic
1007675926 6:43594946-43594968 CTGGGGAGGTGGGGGGCATATGG + Intronic
1007732320 6:43954692-43954714 GGGGGAGGGTGGAGGGCAGAGGG - Intergenic
1007902162 6:45422483-45422505 TTGGGGGGGTGAAGGCGAGACGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1008673536 6:53795984-53796006 CTGCGGGGGTGGACGCGAGATGG + Intronic
1008925638 6:56889387-56889409 CTGAGGAGTTGGAGGACATATGG - Intronic
1009593814 6:65708969-65708991 GAGGGGGGGGAGAGGACAGAAGG - Intergenic
1010367903 6:75073600-75073622 CAGGGTGGGTGAAGGACAGTGGG - Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012959014 6:105602833-105602855 ACTGTGGGGTGGAGGACAGAAGG - Intergenic
1013304889 6:108838682-108838704 CTGGGGAGGCGGAGGCGAGAGGG + Intergenic
1013309331 6:108879089-108879111 ATGGATGGGTGGATGACAGATGG - Intronic
1013327064 6:109056924-109056946 CAGGGGAGGGAGAGGACAGATGG - Intronic
1013935100 6:115584843-115584865 GTGAGGGGGAGGAGTACAGATGG - Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014633091 6:123811421-123811443 GTGGGGGGGTGGGGGAGAGAGGG + Intronic
1015856383 6:137629661-137629683 CTGGAGGCGTGGAGCACAGGCGG - Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016355750 6:143216366-143216388 CAGGGAGGATGGAGGACAAAAGG + Intronic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016848252 6:148590657-148590679 CTGGTGGGGAGGAGGAAATAAGG + Intergenic
1018425448 6:163676345-163676367 CTGGGGAGGTGGCTGACAGGTGG - Intergenic
1018527915 6:164734704-164734726 CTGAGGGGGTGGGGGACCGGGGG - Intergenic
1018735724 6:166685942-166685964 CTAGGAGGGAGGGGGACAGAGGG + Intronic
1018771794 6:166976993-166977015 CTGGTGGAGGGGAGGACACATGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019173758 6:170149381-170149403 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019173847 6:170149846-170149868 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019559082 7:1647050-1647072 CATCCGGGGTGGAGGACAGATGG + Intergenic
1019656747 7:2200075-2200097 CGGGAGGGGTGGAGGATGGAGGG - Intronic
1019718069 7:2550714-2550736 CTGGGAGGGAGGAGGAAACAGGG + Intronic
1019781673 7:2944060-2944082 GTGGGGGAATGGAGGACACAGGG - Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020309875 7:6859515-6859537 CTGGGGGGGGGCAGGGCAGGTGG - Intergenic
1020319510 7:6929560-6929582 TTGGGGGGGTGGAGCCCAGGTGG + Intergenic
1022019811 7:26387625-26387647 CGAGGGGGGTGGAGGAAGGAAGG - Intergenic
1023514485 7:40987295-40987317 CTGGTGGGGTGGAGGAGAGGAGG + Intergenic
1023863077 7:44227025-44227047 AGGGGGGTGTGGAAGACAGAGGG + Intronic
1023863084 7:44227043-44227065 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863110 7:44227117-44227139 GAGGGAGTGTGGAGGACAGAGGG + Intronic
1023863153 7:44227248-44227270 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863180 7:44227323-44227345 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863191 7:44227358-44227380 CAGGAGGTGTGGGGGACAGACGG + Intronic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1023993823 7:45146557-45146579 CTGGGGGGCTGGCGGACATCAGG + Intergenic
1024548590 7:50541958-50541980 CTTGGGGAGTGGTGGAGAGAGGG + Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1025094656 7:56087777-56087799 CTGGGAGTGCAGAGGACAGATGG + Intronic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026414432 7:70163343-70163365 GTGGGGGGGGGGGGGGCAGAGGG + Intronic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026739031 7:72966977-72966999 CTGGGGAAGGGGAGGAGAGAAGG - Intronic
1026771290 7:73201581-73201603 CTGGGGGGCTGGAAGACAAAGGG - Intergenic
1026828302 7:73597116-73597138 CAGGGGGTGGGGAGGACAGGGGG - Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1026907137 7:74069026-74069048 CTGGGGGGAGGGAGGAGGGAAGG + Intronic
1027012157 7:74754978-74755000 CTGGGGGGCTGGAAGACAAAGGG - Intronic
1027075884 7:75191076-75191098 CTGGGGGGCTGGAAGACAAAGGG + Intergenic
1027104702 7:75398096-75398118 CTGGGGAAGGGGAGGAGAGAAGG + Intronic
1027217911 7:76196040-76196062 CTGGGGAGGGGGAGGACACAGGG + Intergenic
1027646674 7:80809942-80809964 ATCAGGGGCTGGAGGACAGAGGG + Intronic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1028621881 7:92835256-92835278 TTGGGGGGATGCAGGACAGGCGG - Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1028985085 7:97003233-97003255 TGTGGGGGGTGGGGGACAGAAGG - Intergenic
1029313089 7:99686016-99686038 CTCGGGGGGTGGAGCCAAGATGG + Intronic
1029490524 7:100867812-100867834 GTGGGGTGGCGGAGGACAGGAGG - Intronic
1029605593 7:101597863-101597885 GTGGGGGTGGGGAGGATAGAAGG - Intergenic
1029637368 7:101793970-101793992 CTGGAGGGCTGGAGCACTGATGG + Intergenic
1029892387 7:103944266-103944288 CTAGGCGTGTGGAGGACAGTAGG + Intronic
1030638698 7:111979556-111979578 CTGGCGGGGTGGAGGGGGGATGG - Intronic
1030753791 7:113263945-113263967 TTTGGAGGGTGGAGGATAGAGGG - Intergenic
1031905876 7:127458953-127458975 CTGGGGTGGTGGCGGCCACAGGG + Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1033046736 7:137968884-137968906 CTAGGGGGTTGGAGAAAAGAAGG + Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1034269114 7:149795164-149795186 CTGGAGTAGGGGAGGACAGAGGG - Intergenic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034348212 7:150399777-150399799 CTGGGGCGGTGCAGGATGGAAGG - Intronic
1034646192 7:152649954-152649976 ATGGTGGCGTGGAAGACAGAAGG + Intronic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034955991 7:155335159-155335181 CTGGGGGGAATGAGGACTGAGGG - Intergenic
1034956323 7:155337610-155337632 CTGAGGGGGTAGAGCATAGAGGG + Intergenic
1035198856 7:157246795-157246817 CCGGGGGTGTGGAGAACAGGTGG - Intronic
1035278903 7:157765227-157765249 GTGGGTGGGTGGATGAAAGAAGG - Intronic
1035520736 8:273730-273752 GTGGGGGGTTGGGGGACTGAGGG + Intergenic
1035622485 8:1044381-1044403 CTGGGCAGGTGGAGGAGAGATGG - Intergenic
1035659268 8:1334580-1334602 CTGGGGGGGTCGAGGGCAGGTGG - Intergenic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1035945309 8:3955164-3955186 CACGGGTGGTGGAGGACAGGAGG - Intronic
1036406470 8:8459795-8459817 CTGGGGGAGAGGGGCACAGATGG + Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037801788 8:22040023-22040045 CTGGGGGGGTGGGGTTCAGGAGG - Intergenic
1038865777 8:31437248-31437270 GTGGGGGGGTGGGGGGCAAAAGG + Intergenic
1039009165 8:33074367-33074389 CTGGTGGGGTGGAGCAGGGAGGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1040539539 8:48339995-48340017 ATGAGGGGGTGGAGGCTAGATGG - Intergenic
1040891938 8:52326266-52326288 GTGGGGAAGGGGAGGACAGAGGG + Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1042540555 8:69903558-69903580 CTGGTGGGGAAGAGGACGGATGG + Intergenic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1045888093 8:107123399-107123421 CTGGTGGGGCGGGGGACGGAGGG - Intergenic
1047164415 8:122421193-122421215 TTGGGGGCAGGGAGGACAGAGGG + Intergenic
1047306916 8:123659848-123659870 CTGGGTGGGTGAAGGATGGATGG - Intergenic
1047585084 8:126262762-126262784 CTGGGGGGATGCAAGACATATGG + Intergenic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1048705556 8:137149226-137149248 CTGGGGCGGTGGAGGAGTGGGGG + Intergenic
1049194382 8:141307737-141307759 CTGGGGGCGGGGAGGACTGATGG + Intronic
1049288291 8:141788368-141788390 CTGTGGGCGTGGAGCACGGAGGG - Intergenic
1049465024 8:142747150-142747172 GTGGGTGGGTGGAGGAGGGATGG + Intergenic
1049510060 8:143022779-143022801 CTGGGCTGGGGCAGGACAGACGG + Intronic
1049606222 8:143530355-143530377 CTGGGTGGGTGAAGCAGAGAGGG + Intronic
1049621410 8:143599896-143599918 CAGGGGGAGGGGAGGAGAGATGG - Exonic
1050028136 9:1356914-1356936 CAGGTGGGGAGCAGGACAGATGG - Intergenic
1050099771 9:2106593-2106615 GTGGTGGGATGGGGGACAGAAGG - Intronic
1050871676 9:10579068-10579090 GTCAAGGGGTGGAGGACAGAGGG - Intronic
1050961211 9:11734303-11734325 CTGAGGTGGTGGATGACAGATGG + Intergenic
1051353861 9:16223394-16223416 CTGGTGGGGTGGGGCACGGAAGG - Intronic
1051767432 9:20540352-20540374 CTGGAAGGGTGGAGGCCACATGG - Intronic
1052832624 9:33228574-33228596 CTGGGAGGGAAGAGGAGAGACGG + Intronic
1052837368 9:33261798-33261820 CAGGGGGGTGGGAAGACAGAGGG + Intronic
1053281287 9:36821055-36821077 CTGGTGGGGTTGGGGGCAGATGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053799758 9:41756995-41757017 GAGGGGGGAGGGAGGACAGAGGG - Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054145453 9:61557939-61557961 GAGGGGGGAGGGAGGACAGAGGG + Intergenic
1054650348 9:67619526-67619548 GAGGGGGGAGGGAGGACAGAGGG + Intergenic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1055474345 9:76646668-76646690 CTGGGGGAGTAGAGACCAGATGG - Intronic
1055992545 9:82123061-82123083 CTGGGGTGGTCAAGGAGAGAAGG + Intergenic
1056255455 9:84794997-84795019 TTTGGGGGGTGGAGGGCACAGGG - Intronic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057008719 9:91583289-91583311 ATGGGTGGGTGGAGGATGGATGG + Intronic
1057054102 9:91948838-91948860 CTGCGGGGGTGGAGGAGGGCGGG - Intronic
1058998912 9:110327780-110327802 ATTGGGGGGTGGAGGATGGAGGG + Intronic
1059155466 9:111985018-111985040 GTGGAGGGGTGGAGGAAGGAAGG + Intergenic
1059512422 9:114861903-114861925 CTGGGGGTATGGAGAACATAGGG - Intergenic
1060046400 9:120344769-120344791 GTGGGGGCGGGGAGGTCAGATGG - Intergenic
1060106572 9:120876809-120876831 CGGGGTGGGGGAAGGACAGACGG - Intronic
1060199951 9:121646505-121646527 GTGGGGGTGGGGGGGACAGAGGG - Intronic
1060495369 9:124114665-124114687 CTGGGTGGGTGGGGGGCAGTTGG - Intergenic
1060875966 9:127083875-127083897 CTGGAGTGGGGGAAGACAGATGG + Intronic
1060940606 9:127541012-127541034 ATGGGGAGGTGGGGGAAAGAGGG + Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1061491008 9:130944413-130944435 CTGGAGGGGTGGAGGGCTGGAGG + Intergenic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061868640 9:133508197-133508219 CTGGGGAGGTGCAGGGCACAGGG + Intergenic
1061994522 9:134176961-134176983 CATGGGGGGAGGAGGAGAGACGG - Intergenic
1061994537 9:134177007-134177029 CATGGGGGGAGGAGGAGAGACGG - Intergenic
1062184913 9:135213050-135213072 CTGGAGGGAGGGAGGACAGCAGG + Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062480274 9:136747840-136747862 CTGGAGGGCTGGAGAACTGAAGG - Intronic
1203470644 Un_GL000220v1:114123-114145 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1203478465 Un_GL000220v1:158095-158117 CGGGGGAGGAGGAGGACGGACGG - Intergenic
1185850119 X:3477393-3477415 ATGGGGCCGTGGAGGAGAGAGGG - Intergenic
1186130464 X:6460116-6460138 GTGGGGGGGTAGAGGGTAGATGG + Intergenic
1188525478 X:31083445-31083467 CTTGGGGGGTGGAGCCAAGATGG - Intergenic
1189160004 X:38801663-38801685 GGGGAGGGGTGGAGGCCAGAAGG + Intronic
1189183020 X:39020847-39020869 CTGGGGGGTTGGAGGAGGAAAGG + Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190429656 X:50367062-50367084 CTGCGGAGGTGGAGCACAGGTGG + Exonic
1190476643 X:50834603-50834625 CATGGGGTGTGGAGTACAGAGGG - Intergenic
1190487432 X:50941841-50941863 CTCTGCTGGTGGAGGACAGAGGG + Intergenic
1190570771 X:51779159-51779181 GTGGGGGGGTGGTAGCCAGAGGG + Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1191593176 X:62911949-62911971 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
1191654140 X:63577490-63577512 TTGAGGGGGAGGGGGACAGAGGG - Intergenic
1192153436 X:68726053-68726075 GTGGGGGGGTGGGGCAGAGAAGG + Intergenic
1192488355 X:71550892-71550914 TTGGGGGGGTGGAGGAGGGATGG + Intronic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1193812412 X:86067288-86067310 GTTGGGGGGTGGAGGAGACATGG - Intergenic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1195081084 X:101371554-101371576 GTGGTGGGGTGCAGGGCAGAGGG - Intronic
1195168558 X:102244580-102244602 CTTGGGGGGTGGGGGAGATAAGG - Intergenic
1195190299 X:102442507-102442529 CTTGGGGGGTGGGGGAGATAAGG + Intronic
1195402420 X:104475673-104475695 GTGGGTGGGGGGATGACAGAGGG - Intergenic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195766601 X:108302989-108303011 TTGGGGGGGTGGAGGGGGGAGGG - Intronic
1195803677 X:108737989-108738011 CTGGGGTGGTGGGGGAGAGAGGG - Intergenic
1196109168 X:111927574-111927596 CCGGGGCTGTGGAGGACTGAAGG + Intronic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1197089599 X:122521136-122521158 CTGGAGGGGTGGAGCACTCATGG - Intergenic
1197357251 X:125450558-125450580 TTGGGTGGGTGGGGGGCAGAGGG + Intergenic
1197515606 X:127423973-127423995 CTGAGGAGGAGGAGGACAGAGGG - Intergenic
1198242047 X:134796644-134796666 AGGGGAGGGAGGAGGACAGAGGG + Intronic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1199206937 X:145160005-145160027 CTGCAGGGGTGGAGCACACATGG - Intergenic
1199223377 X:145343169-145343191 CTGGGGAGGTGCAAGAGAGAAGG + Intergenic
1199944171 X:152652462-152652484 CTGGGGGGAGGGAGGAGGGAAGG - Intronic
1200080008 X:153571648-153571670 GTGGGGAGGAGGGGGACAGATGG - Intronic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic